ID: 1056165464

View in Genome Browser
Species Human (GRCh38)
Location 9:83936862-83936884
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056165458_1056165464 24 Left 1056165458 9:83936815-83936837 CCTTATTTTTTTTTAAGAGACTG No data
Right 1056165464 9:83936862-83936884 GACATGAACTCCTACGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056165464 Original CRISPR GACATGAACTCCTACGTTCA AGG Intergenic
No off target data available for this crispr