ID: 1056170473

View in Genome Browser
Species Human (GRCh38)
Location 9:83980249-83980271
Sequence AATAGGGCGCGACGGCGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056170473_1056170485 7 Left 1056170473 9:83980249-83980271 CCTCCCCGCCGTCGCGCCCTATT 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1056170485 9:83980279-83980301 AGGGCTTCAGCGATGGTGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 83
1056170473_1056170483 0 Left 1056170473 9:83980249-83980271 CCTCCCCGCCGTCGCGCCCTATT 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1056170483 9:83980272-83980294 GGCTGCCAGGGCTTCAGCGATGG 0: 1
1: 0
2: 1
3: 30
4: 281
1056170473_1056170487 20 Left 1056170473 9:83980249-83980271 CCTCCCCGCCGTCGCGCCCTATT 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36
1056170473_1056170488 27 Left 1056170473 9:83980249-83980271 CCTCCCCGCCGTCGCGCCCTATT 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1056170473_1056170486 8 Left 1056170473 9:83980249-83980271 CCTCCCCGCCGTCGCGCCCTATT 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1056170486 9:83980280-83980302 GGGCTTCAGCGATGGTGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056170473 Original CRISPR AATAGGGCGCGACGGCGGGG AGG (reversed) Exonic
900242909 1:1625434-1625456 CACAGGGCTCCACGGCGGGGCGG - Intronic
900275810 1:1826736-1826758 AGTAGGGCGAGAAGGCAGGGCGG - Intronic
900684411 1:3938977-3938999 AATAGGGCAGGACAGCGGTGTGG - Intergenic
901789786 1:11648118-11648140 AATAGGGCATGTTGGCGGGGGGG - Intergenic
903464655 1:23543719-23543741 AATAGGGAGAGATGGAGGGGAGG - Intergenic
905048916 1:35031773-35031795 TAGTGGGCGGGACGGCGGGGCGG - Intronic
913703301 1:121395956-121395978 AATAAGCCGCGGCGGCGGGGGGG - Intergenic
913703358 1:121396153-121396175 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
913939168 1:125086448-125086470 ATTAAGCCGCGGCGGCGGGGCGG + Intergenic
913939186 1:125086513-125086535 AAAAAGTCGCGGCGGCGGGGTGG + Intergenic
913939594 1:125087981-125088003 AAAAAGCCGCGGCGGCGGGGGGG + Intergenic
913979477 1:143497123-143497145 AATAAGCCGCGGCGGCGGGGGGG - Intergenic
914044330 1:144078007-144078029 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
914073878 1:144322767-144322789 AATAAGCCGCGGCGGCGGGGGGG - Intergenic
914105276 1:144643593-144643615 AATAAGCCGCGGCGGCGGGGGGG + Intergenic
914133781 1:144882680-144882702 AAAAAGCCGCGGCGGCGGGGGGG + Intergenic
914133845 1:144882855-144882877 AAAAAGCCGCGTCGGCGGGGGGG + Intergenic
914133861 1:144882911-144882933 AAAAAGCCGCGTCGGCGGGGGGG + Intergenic
922586623 1:226738428-226738450 CATAGGGGACGACGGCAGGGGGG - Intronic
1066956492 10:42177836-42177858 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1066956529 10:42177946-42177968 AAAAAGCCGCGACGGCGGGGGGG - Intergenic
1066963759 10:42242963-42242985 AAAAAGTCGCGGCGGCGGGGGGG - Intergenic
1066963905 10:42243470-42243492 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1066963914 10:42243494-42243516 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1066963923 10:42243518-42243540 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1066963943 10:42243604-42243626 AAAAAGTCGCGGCGGCGGGGGGG - Intergenic
1073705089 10:105973988-105974010 GATAGGGCGGGAGTGCGGGGAGG - Intergenic
1076501099 10:130936617-130936639 AATAGGACGTCCCGGCGGGGAGG + Intergenic
1090366643 11:126211978-126212000 AAGGGGGCGCGGGGGCGGGGAGG - Intronic
1094835520 12:34320296-34320318 AATATGGCGCGACGTAGGAGGGG - Intergenic
1115215453 14:31009474-31009496 ACTGGGGCGCGGGGGCGGGGGGG - Intronic
1117097559 14:52314129-52314151 CCTGGGGCGCGCCGGCGGGGAGG - Intergenic
1117602643 14:57390877-57390899 AACAGGGGGCGACGGATGGGGGG - Intronic
1118992277 14:70808427-70808449 AATGGGGGGCGGCGGGGGGGTGG + Intronic
1119484210 14:74977696-74977718 AATTGGGTGCGGCTGCGGGGAGG + Intergenic
1123396714 15:19944263-19944285 AAAAAGCCGCGGCGGCGGGGTGG - Intergenic
1123396742 15:19944367-19944389 AAAAAGCCGCGGCGGCGGGGAGG - Intergenic
1129761380 15:78131105-78131127 AAAAGGGAGGGGCGGCGGGGCGG + Intronic
1136698981 16:32115661-32115683 AAAAAGCCGCGGCGGCGGGGCGG - Intergenic
1136699037 16:32115882-32115904 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1136737822 16:32478569-32478591 AAAAAGCCGCGTCGGCGGGGTGG + Intergenic
1136957469 16:34803116-34803138 AAAAAGTCGCGGCGGCGGGGTGG - Intergenic
1203015251 16_KI270728v1_random:351008-351030 AAAAAGCCGCGTCGGCGGGGTGG - Intergenic
1203033586 16_KI270728v1_random:624166-624188 AAAAAGCCGCGTCGGCGGGGTGG - Intergenic
1145327179 17:21842328-21842350 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1145327338 17:21842932-21842954 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1145693396 17:26766857-26766879 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1147840493 17:43368344-43368366 AATAGGGCCAGCCTGCGGGGAGG - Intergenic
1148576960 17:48719076-48719098 AACAGGGCGCGCCGGCGCGCGGG - Intergenic
1162299307 19:9835267-9835289 AATAGGCAGCGGCGGCGGGCGGG + Intronic
1164992100 19:32692049-32692071 CGGCGGGCGCGACGGCGGGGTGG - Exonic
1166259451 19:41627475-41627497 AATGGGGGGCGACTACGGGGGGG + Intronic
1167110485 19:47457711-47457733 GATAGGGAGAGACGACGGGGCGG - Intronic
1202680941 1_KI270712v1_random:5420-5442 AAAAAGCCGCGGCGGCGGGGGGG + Intergenic
1202681412 1_KI270712v1_random:7082-7104 AATAAGCCTCGGCGGCGGGGGGG + Intergenic
1202683377 1_KI270712v1_random:29670-29692 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1202683848 1_KI270712v1_random:31300-31322 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
927327506 2:21822266-21822288 ATTAAGGCGGGAAGGCGGGGCGG + Intergenic
929778828 2:44944491-44944513 AATGGGGAGCGGCGGCGCGGGGG + Intronic
929782323 2:44965019-44965041 ATTAGGGGGCGACAGGGGGGCGG + Intergenic
934261032 2:91477563-91477585 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
934261058 2:91477633-91477655 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
934304371 2:91809600-91809622 AAAAAGCCGCGACGGCGTGGGGG - Intergenic
934328886 2:92043150-92043172 AAAAAGCCGCGACGGCGTGGGGG + Intergenic
934467153 2:94273254-94273276 AAAAAGCCGCGTCGGCGGGGGGG + Intergenic
936561417 2:113542248-113542270 GAGAGGGCGCGGCGGCGGCGCGG - Intergenic
937432543 2:121851536-121851558 ATTAGGGCCCGAGGGCAGGGAGG + Intergenic
1172983404 20:38962317-38962339 CCTAGCGCGCGACGGTGGGGTGG + Exonic
1173548122 20:43914730-43914752 AATAGCGCGCGCGGGCGGGGCGG + Intergenic
1173811600 20:45959283-45959305 AAGAAGGGGCGACGGCGGGAGGG + Exonic
1173822542 20:46028838-46028860 ACTAGGTCGCGGCCGCGGGGAGG - Intronic
1176586752 21:8595260-8595282 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1176586761 21:8595284-8595306 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1176586865 21:8595670-8595692 AAAAAGTCGCGGCGGCGGGGGGG - Intergenic
1180269599 22:10572288-10572310 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1180269692 22:10572644-10572666 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1181147442 22:20858850-20858872 GATAGGGCGTGGCTGCGGGGCGG + Intronic
954686581 3:52373316-52373338 GCGGGGGCGCGACGGCGGGGCGG + Intronic
955238965 3:57163778-57163800 AATGGGGCGGGGGGGCGGGGGGG + Intronic
984167428 4:176319820-176319842 GTTAGGCCGCGACGGAGGGGCGG + Intergenic
998108079 5:139481274-139481296 AACAGGGCCCCACGGCGGAGGGG + Exonic
998463191 5:142324350-142324372 CATAGGCCGCTACGGCGGGCTGG + Intronic
1002696845 5:181097941-181097963 CACAGGGCGCGACTCCGGGGAGG + Intergenic
1002697777 5:181101432-181101454 CACAGGGCGCGACTCCGGGGAGG - Intergenic
1002887987 6:1312666-1312688 AAGAGGGTACGACGCCGGGGAGG + Exonic
1003590356 6:7431970-7431992 CATAGGGCGGGACAGCAGGGCGG + Intergenic
1006776470 6:36596559-36596581 AATGGGGCGGGGTGGCGGGGGGG + Intronic
1017696674 6:157022129-157022151 AACAGGGCGGGGAGGCGGGGCGG + Intronic
1018786999 6:167116313-167116335 AAGAGGGAGCGAGGGCGGGGAGG - Intergenic
1025481667 7:60991860-60991882 AAAAAGCCGCGTCGGCGGGGGGG - Intergenic
1025561910 7:62380389-62380411 AAAAAGTCGCGGCGGCGGGGCGG - Intergenic
1038632854 8:29262697-29262719 AAAAGGGCGCAGGGGCGGGGCGG + Intronic
1049891269 9:73092-73114 GAGAGGGCGCGGCGGCGGCGCGG + Intergenic
1053697264 9:40650255-40650277 AATAAGCCGCGTCGGCGGGGGGG + Intergenic
1054308509 9:63449473-63449495 AATAAGCCGCGTCGGCGGTGGGG + Intergenic
1054407202 9:64773317-64773339 AAAAAGCCGCGTCGGCGGGGGGG + Intergenic
1054407512 9:64774366-64774388 AAAAAGCCGCGGCGGCGGGGGGG + Intergenic
1054407533 9:64774430-64774452 AAAAAGCCGCGGCGGCGGGGGGG + Intergenic
1054489569 9:65763112-65763134 AATAAGCCGCGTCGGCGGGGGGG - Intergenic
1056170473 9:83980249-83980271 AATAGGGCGCGACGGCGGGGAGG - Exonic
1057363680 9:94398805-94398827 CGGAGGGCGCGACGGGGGGGAGG - Intronic
1057659655 9:96989282-96989304 CGGAGGGCGCGACGGGGGGGAGG + Intronic
1203616738 Un_KI270749v1:73068-73090 AAAAAGCCGCGACGGCGGGGGGG - Intergenic
1203616758 Un_KI270749v1:73132-73154 AAAAAGCCGCGGCGGCGGGGGGG - Intergenic
1187873489 X:23783560-23783582 AATGGGGCGGGCGGGCGGGGTGG - Intronic
1194268268 X:91780310-91780332 AATAGGGCGGGAAGGAAGGGCGG - Intronic
1200585468 Y:5001222-5001244 AATAGGGCGGGAAGGAAGGGCGG - Intronic
1201522716 Y:14893767-14893789 TATAGGGCGGGGCGGGGGGGGGG + Intergenic