ID: 1056170476

View in Genome Browser
Species Human (GRCh38)
Location 9:83980253-83980275
Sequence AGCCAATAGGGCGCGACGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056170476_1056170486 4 Left 1056170476 9:83980253-83980275 CCCGCCGTCGCGCCCTATTGGCT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1056170486 9:83980280-83980302 GGGCTTCAGCGATGGTGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1056170476_1056170483 -4 Left 1056170476 9:83980253-83980275 CCCGCCGTCGCGCCCTATTGGCT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1056170483 9:83980272-83980294 GGCTGCCAGGGCTTCAGCGATGG 0: 1
1: 0
2: 1
3: 30
4: 281
1056170476_1056170487 16 Left 1056170476 9:83980253-83980275 CCCGCCGTCGCGCCCTATTGGCT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36
1056170476_1056170488 23 Left 1056170476 9:83980253-83980275 CCCGCCGTCGCGCCCTATTGGCT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1056170476_1056170485 3 Left 1056170476 9:83980253-83980275 CCCGCCGTCGCGCCCTATTGGCT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1056170485 9:83980279-83980301 AGGGCTTCAGCGATGGTGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056170476 Original CRISPR AGCCAATAGGGCGCGACGGC GGG (reversed) Exonic
900386436 1:2413022-2413044 AGCTCAAAGGGCGCGAGGGCGGG - Intronic
923024855 1:230196180-230196202 ACCCAGTAGGGAGGGACGGCAGG - Intronic
1066954345 10:42150319-42150341 AGGCAAAAGGCCACGACGGCGGG + Intergenic
1089273247 11:117315804-117315826 AGCCCAGAGGGCCCGAAGGCCGG - Exonic
1094482644 12:30896962-30896984 AGGCAATAGGGGGCTACTGCAGG - Intergenic
1100431402 12:94534578-94534600 AGCCAATATGGCGCCATGGAGGG + Intergenic
1106411345 13:29513669-29513691 AGCCAGTCGGGGGAGACGGCAGG + Exonic
1122408806 14:101515704-101515726 AGCCAATAGGGCCCGGCCTCAGG - Intergenic
1124340184 15:28885587-28885609 AGCAAGCAGGGCGCGGCGGCCGG + Intronic
1132834059 16:1943504-1943526 AGCCACCAGGGCGCGAGGGGCGG - Intergenic
1145709892 17:26962650-26962672 GGGCAAAAGGCCGCGACGGCAGG - Intergenic
1148679106 17:49463099-49463121 AGCCAATAGGGAGCCACTGAAGG - Intronic
1150255466 17:63741349-63741371 AGCCCAAAGTGCGCGGCGGCTGG + Intronic
1162299304 19:9835263-9835285 AGCCAATAGGCAGCGGCGGCGGG + Intronic
1166937990 19:46346645-46346667 CGACAATAGGGCTCGACGCCCGG + Intergenic
1167434718 19:49472832-49472854 AGGCAATAGGGCGATAGGGCAGG + Intronic
1167648738 19:50718848-50718870 AGCCGAGGGGGCGCGCCGGCCGG + Intronic
1173337248 20:42122766-42122788 AGACAATAGGGAGCTACTGCAGG - Intronic
1175780870 20:61681164-61681186 AGCCATTAGGACGTGAGGGCGGG - Intronic
962757726 3:138479524-138479546 TGCCAATAGGGGGCGATGGAAGG + Intronic
968480986 4:832928-832950 AGCCCAGAGGGCCCGAGGGCTGG - Intergenic
983913743 4:173268581-173268603 AGCCAAGATGGCGCCACGCCTGG - Intronic
990347437 5:54884089-54884111 AGCCAGTAGGACGAGGCGGCGGG + Intergenic
1002323351 5:178388777-178388799 AGGCAATAGGGAGCCACTGCAGG - Intronic
1006134825 6:31888921-31888943 AGCCACTAGGGGGCGACCTCAGG - Intronic
1024974913 7:55104431-55104453 AGCCAATAGGCAGCTAGGGCAGG - Intronic
1025878535 7:65509776-65509798 AGGCAAAAAGCCGCGACGGCAGG + Intergenic
1056170476 9:83980253-83980275 AGCCAATAGGGCGCGACGGCGGG - Exonic
1060252049 9:121994543-121994565 AGCCAATAGGTCACAAAGGCAGG + Intronic
1061522217 9:131125488-131125510 GGCCAATGGGGAGCGGCGGCCGG + Intergenic
1200253692 X:154567956-154567978 AGCCAATAGGGCAGGCAGGCTGG - Intergenic
1200264077 X:154636452-154636474 AGCCAATAGGGCAGGCAGGCTGG + Intergenic