ID: 1056170477

View in Genome Browser
Species Human (GRCh38)
Location 9:83980254-83980276
Sequence CAGCCAATAGGGCGCGACGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 31}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056170477_1056170483 -5 Left 1056170477 9:83980254-83980276 CCGCCGTCGCGCCCTATTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1056170483 9:83980272-83980294 GGCTGCCAGGGCTTCAGCGATGG 0: 1
1: 0
2: 1
3: 30
4: 281
1056170477_1056170488 22 Left 1056170477 9:83980254-83980276 CCGCCGTCGCGCCCTATTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1056170477_1056170485 2 Left 1056170477 9:83980254-83980276 CCGCCGTCGCGCCCTATTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1056170485 9:83980279-83980301 AGGGCTTCAGCGATGGTGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 83
1056170477_1056170487 15 Left 1056170477 9:83980254-83980276 CCGCCGTCGCGCCCTATTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36
1056170477_1056170486 3 Left 1056170477 9:83980254-83980276 CCGCCGTCGCGCCCTATTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1056170486 9:83980280-83980302 GGGCTTCAGCGATGGTGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056170477 Original CRISPR CAGCCAATAGGGCGCGACGG CGG (reversed) Exonic
900386437 1:2413023-2413045 CAGCTCAAAGGGCGCGAGGGCGG - Intronic
902699075 1:18159283-18159305 CAGGCAATAGGGAGCCATGGAGG + Intronic
920850380 1:209624312-209624334 CAGCCCATAGAGAGCGAAGGAGG - Intronic
1069628930 10:69885863-69885885 CAACCAAAAGGGCACGAGGGAGG - Intronic
1073244792 10:102082174-102082196 CAGCCAATAGGTGGTGAAGGAGG - Intergenic
1100431401 12:94534577-94534599 AAGCCAATATGGCGCCATGGAGG + Intergenic
1100711418 12:97261049-97261071 CAGCCAAAAGCAGGCGACGGTGG + Intergenic
1104475533 12:129067699-129067721 CGGCCAATAGGAGGCAACGGAGG + Intergenic
1105326460 13:19374633-19374655 CAGCCAACATGGCACGAAGGAGG + Intergenic
1105867045 13:24470353-24470375 CAGCCAACATGGCACGAAGGAGG - Intronic
1125979840 15:43990047-43990069 CAGACACCAGGGCGTGACGGTGG - Intronic
1146184871 17:30718211-30718233 CAGGCAATAGGGAGCCATGGAGG + Intergenic
1160870453 19:1275458-1275480 CAGCCAATGGGGCGCGGAGGCGG - Exonic
1161658523 19:5531033-5531055 CAGCCAATAGGGAGAAACTGAGG + Intergenic
1162299303 19:9835262-9835284 TAGCCAATAGGCAGCGGCGGCGG + Intronic
1162833810 19:13303322-13303344 CAGCCAAGAGGGTGGGAAGGGGG - Intronic
1162973910 19:14197484-14197506 CAGGCAATAGGGAGCCATGGAGG - Intronic
1163419323 19:17205437-17205459 CAGCCAGTAGGGGGCGGCTGTGG + Intronic
931636091 2:64341761-64341783 CAGCCAATGGGGAGTGAGGGAGG + Intergenic
939617833 2:144380270-144380292 CAGCAAACAGGACGCCACGGTGG - Intergenic
950674529 3:14546543-14546565 CAGCCAATAGGGCACGTTTGAGG + Intergenic
955406256 3:58627432-58627454 CAGCCGACAGGGCCAGACGGTGG + Exonic
971158411 4:24107730-24107752 CAGGCAATAGGGAGCCATGGAGG + Intergenic
976092211 4:81470919-81470941 CAGGGAAAAGGGCGAGACGGGGG - Intronic
990347436 5:54884088-54884110 CAGCCAGTAGGACGAGGCGGCGG + Intergenic
1007241006 6:40425177-40425199 CTGCAGATAGGGCGCGACAGGGG + Intronic
1025829641 7:65038251-65038273 GAGCCAATGGGGCGCGGCGGCGG + Intergenic
1025916883 7:65873225-65873247 GAGCCAATGGGGCGCGGCGGCGG + Intergenic
1049219183 8:141421128-141421150 CAGCCAGCAGGGCATGACGGAGG - Intronic
1056170477 9:83980254-83980276 CAGCCAATAGGGCGCGACGGCGG - Exonic
1060566770 9:124599574-124599596 CCGCCATGAGGGCGCGGCGGCGG + Intronic
1061190695 9:129081082-129081104 CAGCCAATGGGGAGCCAGGGGGG - Exonic
1198466771 X:136910365-136910387 CAGCCAATAGGGAGGGAAGTGGG - Intergenic
1199403246 X:147425240-147425262 CAGCCAAGAGGGAGGGGCGGGGG + Intergenic
1202605335 Y:26634979-26635001 CAGCCAACATGGCACGAAGGAGG - Intergenic