ID: 1056170478

View in Genome Browser
Species Human (GRCh38)
Location 9:83980257-83980279
Sequence TGGCAGCCAATAGGGCGCGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 43}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056170478_1056170483 -8 Left 1056170478 9:83980257-83980279 CCGTCGCGCCCTATTGGCTGCCA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1056170483 9:83980272-83980294 GGCTGCCAGGGCTTCAGCGATGG 0: 1
1: 0
2: 1
3: 30
4: 281
1056170478_1056170485 -1 Left 1056170478 9:83980257-83980279 CCGTCGCGCCCTATTGGCTGCCA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1056170485 9:83980279-83980301 AGGGCTTCAGCGATGGTGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 83
1056170478_1056170486 0 Left 1056170478 9:83980257-83980279 CCGTCGCGCCCTATTGGCTGCCA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1056170486 9:83980280-83980302 GGGCTTCAGCGATGGTGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 73
1056170478_1056170487 12 Left 1056170478 9:83980257-83980279 CCGTCGCGCCCTATTGGCTGCCA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36
1056170478_1056170488 19 Left 1056170478 9:83980257-83980279 CCGTCGCGCCCTATTGGCTGCCA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056170478 Original CRISPR TGGCAGCCAATAGGGCGCGA CGG (reversed) Exonic
912561009 1:110551589-110551611 TGGCAGCCAACTGGGAGAGAAGG - Intergenic
922055201 1:222036007-222036029 TGGCAGCCAATAGGGGAGGGAGG + Intergenic
1069087904 10:64162959-64162981 TGGCAGCCAATAGCTAGAGATGG + Intergenic
1070794586 10:79209365-79209387 TGCCAGCCAACAGGGCCCCATGG + Intronic
1074680108 10:115897571-115897593 TGGAAGACAATAGGGAGTGATGG + Intronic
1077144201 11:1037434-1037456 TGGCTGCCAACAGCGCTCGAAGG - Intergenic
1078210191 11:9264623-9264645 TGGCACCCATTAGGGAGGGAAGG - Intronic
1083558057 11:63648243-63648265 TGGCAACCAGTAGGGTGAGAGGG - Intronic
1085276339 11:75302559-75302581 TGGCAGCCAAAAGGGCCCAGAGG + Intronic
1100431400 12:94534574-94534596 GGGAAGCCAATATGGCGCCATGG + Intergenic
1115530126 14:34319336-34319358 TGGCTGCCAATAGTGGGCGGAGG - Intronic
1118328813 14:64800227-64800249 TGCCAGCCACTAGGGGGCCAGGG + Intronic
1120665601 14:87302999-87303021 TGGCTGCCAATAGGGAGGGTTGG - Intergenic
1124151543 15:27183359-27183381 TGGCAGCGAAAAGGGAGGGAAGG + Intronic
1127272476 15:57413805-57413827 TGGCAGCCAAGCGTGCCCGATGG - Intronic
1128662668 15:69513623-69513645 TGGCAGACAATGGGGAGCCATGG + Intergenic
1137379503 16:47984214-47984236 TGGCAGAGAATAGGGAGTGAAGG + Intergenic
1137558501 16:49488531-49488553 TTTCAGCCAGGAGGGCGCGATGG - Exonic
1137686702 16:50391595-50391617 TGGCAGCCACGAGGGCGCTGTGG - Intergenic
1147043955 17:37739371-37739393 AGGCAGCCAATGGGGTGAGAGGG + Intronic
1147578964 17:41617943-41617965 TGGCAGCAAATGTGGCGCCATGG - Intergenic
1151336594 17:73443646-73443668 TGGCAGCCTGCAGGGCTCGATGG + Intronic
1154170441 18:12047176-12047198 TGGCAGCGAGTAGGGAGCGGGGG - Intergenic
1158393149 18:57059739-57059761 TGGCAGCCAGCAGGGCCCTATGG + Intergenic
1159608368 18:70498843-70498865 TGGCAGCCAATGGGGCTAGAAGG + Intergenic
1160870455 19:1275461-1275483 TGCCAGCCAATGGGGCGCGGAGG - Exonic
1162410425 19:10502384-10502406 TGGCAGCCGAGAGGCCGCGGTGG - Intronic
1163567103 19:18058380-18058402 TGGCAGCCAATAGGGCCAGGAGG - Intergenic
1164457436 19:28420561-28420583 TGGCAGCCAAGAGGGAGAGGTGG + Intergenic
1168259223 19:55183848-55183870 TGACAGGCAATAGGGAGAGACGG - Intronic
925089005 2:1138212-1138234 TGCCAGCCAACAGGGAGCAAAGG - Intronic
926701723 2:15808391-15808413 TGGAAGCCAAGAAGCCGCGATGG + Intergenic
934712916 2:96527457-96527479 TGGCAGCCATTTGGGCCCCAGGG + Intergenic
1172391159 20:34566402-34566424 TGGCAGCCATGAGGGCTCCAGGG + Intronic
1174849334 20:53977085-53977107 TGGCAGGCAAGAGAGAGCGAAGG + Intronic
1180253367 21:46605164-46605186 TGGCAGCCAATGGGAGCCGAAGG + Exonic
956134856 3:66088651-66088673 TGGCATCCACTAGGGCACAATGG + Intergenic
961251483 3:125509989-125510011 TTCCCGCCAATAGGGCACGAGGG - Intronic
965899169 3:173617664-173617686 TGGCAGCCACTTGGCCTCGAGGG - Intronic
1001096497 5:168779513-168779535 TGGCAGCCAAAAGTGCTCCAAGG - Intronic
1002425173 5:179170685-179170707 TGGCAGGCAATAGGGGACCATGG - Intronic
1005824549 6:29624918-29624940 TGGCAGCCAGTGGGGAGCCAGGG + Intronic
1039780433 8:40779751-40779773 TGGCAGCCACCAGGGAGAGATGG - Intronic
1045859272 8:106797120-106797142 TGGCAGCCTATAGGACCCGAGGG + Intergenic
1051667991 9:19483522-19483544 TGACAGCCAATAGGGTGTGAAGG - Intergenic
1056170478 9:83980257-83980279 TGGCAGCCAATAGGGCGCGACGG - Exonic
1062688365 9:137828014-137828036 TGCCAGCCGACAGGGTGCGACGG + Intronic
1192502293 X:71662123-71662145 TGGCTGCCTATAGGACGCCAAGG + Intergenic
1196820013 X:119694165-119694187 AGGCGGCCAATAGGGCGCAGAGG + Intergenic