ID: 1056170481

View in Genome Browser
Species Human (GRCh38)
Location 9:83980265-83980287
Sequence TGAAGCCCTGGCAGCCAATA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056170481_1056170489 26 Left 1056170481 9:83980265-83980287 CCCTATTGGCTGCCAGGGCTTCA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1056170489 9:83980314-83980336 GCCCGAGGCCACGTCAATCAAGG 0: 1
1: 0
2: 1
3: 1
4: 31
1056170481_1056170487 4 Left 1056170481 9:83980265-83980287 CCCTATTGGCTGCCAGGGCTTCA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36
1056170481_1056170488 11 Left 1056170481 9:83980265-83980287 CCCTATTGGCTGCCAGGGCTTCA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1056170481_1056170485 -9 Left 1056170481 9:83980265-83980287 CCCTATTGGCTGCCAGGGCTTCA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1056170485 9:83980279-83980301 AGGGCTTCAGCGATGGTGCGAGG 0: 1
1: 0
2: 0
3: 5
4: 83
1056170481_1056170486 -8 Left 1056170481 9:83980265-83980287 CCCTATTGGCTGCCAGGGCTTCA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1056170486 9:83980280-83980302 GGGCTTCAGCGATGGTGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056170481 Original CRISPR TGAAGCCCTGGCAGCCAATA GGG (reversed) Exonic
900203487 1:1421416-1421438 TGGGGCCCTGGCAGCCAGCAGGG - Exonic
901174631 1:7289940-7289962 TGAAGCCTTGGCAGAGATTAAGG - Intronic
901785430 1:11621641-11621663 TCAAGCCCTGTCCGCCAACAAGG + Intergenic
902661817 1:17909683-17909705 AGGAGCCCAGGCAGCCAATGGGG + Intergenic
904238342 1:29128147-29128169 TGGAGCCCAGGCAGCCCAGATGG - Intergenic
906660669 1:47579220-47579242 TGAAGTCCAGGCAGCCTCTACGG - Intergenic
906762916 1:48393945-48393967 TGAAGCCCTAGCCCCTAATATGG - Intronic
908631279 1:66110989-66111011 TAACGCCCTGGAAGCAAATATGG + Intronic
911300360 1:96165293-96165315 TGAAGTCCAGGCAGGCAAGAGGG + Intergenic
914815586 1:151059796-151059818 TGAGGCCCTGGCACCCAAGCTGG + Exonic
916938324 1:169654455-169654477 TGAAACCCTGGCAGCCCACCTGG + Intergenic
917664003 1:177206209-177206231 TGAAGCCTTGGCAGGCATTATGG + Intronic
921409446 1:214819460-214819482 TGAAGCCATGGAAGACAGTATGG - Intergenic
923850519 1:237789493-237789515 TGCAGCCATGGAAGCCATTATGG - Intronic
923959362 1:239059272-239059294 TCAAGCCCTGGCTGCCTCTAGGG + Intergenic
1065713215 10:28536926-28536948 TGAAGAACTAGCTGCCAATAGGG - Intronic
1067713254 10:48667211-48667233 TGAAGGTCAGGCAGCCAGTAAGG + Intergenic
1068579254 10:58720648-58720670 TGAAGACTTGGTGGCCAATAAGG + Intronic
1069824789 10:71248304-71248326 GGACGCCCTGGGAGCCTATACGG + Intronic
1069887563 10:71633682-71633704 TGGAACCCTGGGAGCCAAGAAGG - Intronic
1070695875 10:78562610-78562632 TGAAGCCCTGGCAAACCATGTGG - Intergenic
1071524534 10:86350504-86350526 TGAAGGACTGGCAGCCAAGCCGG - Intronic
1072151284 10:92686785-92686807 TGAAGACCGGCCTGCCAATATGG - Intergenic
1078642694 11:13111185-13111207 TGAATCACTGGCAGCCAACCAGG + Intergenic
1079104003 11:17558965-17558987 TGAAGCCCTGGCAGTGTCTATGG + Intronic
1079309430 11:19351237-19351259 TTCAGTCCTGGCAGCCAAAAAGG + Intronic
1081227028 11:40536754-40536776 TGAAGCCCTTGCAGAGAAGATGG - Intronic
1081507569 11:43734290-43734312 AGAAGCCGTGGAAGCCAAAAAGG + Intronic
1082606428 11:55238964-55238986 TCAGGACCTGGCAGCCAAGATGG - Intergenic
1082888793 11:58116204-58116226 TGGAGCCCTGGCAGCTATTGTGG - Intronic
1089300508 11:117495977-117495999 GGAAGCCCAGGCAGGCAATGAGG - Intronic
1097023232 12:56035214-56035236 TGAAGCCATGGCAGCCCATGTGG - Exonic
1097154375 12:57002107-57002129 TGAACCCCTGCCAGCCAGAAGGG - Exonic
1099457354 12:82879918-82879940 TGAAGTCCCGGCATCCAGTAAGG - Intronic
1102739246 12:115192378-115192400 TGCAGCCTTGGAAGCCATTATGG + Intergenic
1103487250 12:121291451-121291473 TGAAGCACTGACAGCCACTATGG + Intronic
1104216467 12:126738858-126738880 TGAAGCCCTAACATCCAATCTGG - Intergenic
1106030539 13:25998281-25998303 TTCATCCCTGCCAGCCAATAAGG - Intronic
1106500266 13:30321754-30321776 TGACGCCCAGGCTGCCAATCCGG - Intergenic
1110820538 13:79910304-79910326 AGAAGCCATGGCAGCCACAAAGG + Intergenic
1112188269 13:97149165-97149187 TTCAGCCTTGGCAGCCATTACGG + Intergenic
1114666498 14:24380337-24380359 AAATGCCCTGGCAGCCTATAAGG - Intergenic
1117055754 14:51910583-51910605 TGAAGCCCAGGTAGACAATGAGG - Intronic
1118159519 14:63274522-63274544 ATCAGCCCTGGCATCCAATAAGG + Intronic
1122234030 14:100322138-100322160 TGAGGCCCAGGCAGCCCATCTGG - Intergenic
1122538045 14:102479931-102479953 TGGAGCCCTGCCAGCCAGGAGGG + Intronic
1123218684 14:106837073-106837095 TTCAGACCTGGAAGCCAATATGG - Intergenic
1125878943 15:43175689-43175711 GAAAGCGCTGGCAGCCAAGATGG + Intronic
1125911673 15:43445362-43445384 TGAAGCCATGGAAGCCTATGGGG - Intronic
1128305221 15:66593892-66593914 TGAAGGAATGGCAGCCAAGATGG - Intronic
1132654240 16:1035244-1035266 TCAAGCCCTGGAAGCCAGTGTGG + Intergenic
1137060238 16:35786896-35786918 AAAATCCCTGGCAGCCAAGAAGG + Intergenic
1138952001 16:61923695-61923717 TGAAGCCCTGGCAATCTAGATGG + Intronic
1139464641 16:67147799-67147821 TGCAGCCCTGCCAGCCAGGATGG - Exonic
1140523976 16:75606654-75606676 TGCAGCCCTGGCTGCCATAATGG + Intronic
1141105886 16:81233385-81233407 TGAAGCCCTAACACCCCATACGG + Intergenic
1141163422 16:81644458-81644480 TGAAGACTTGGCGGCCAAAAGGG + Intronic
1142371747 16:89686497-89686519 TGAAGCCCGGGCAGCCGACCCGG - Exonic
1143728308 17:8865403-8865425 TAAAGCCCTGGCAGAAAAGACGG + Intronic
1143741800 17:8959864-8959886 TGAAGGCCTGGCAAAAAATACGG + Intronic
1146750279 17:35373100-35373122 TGCAGCCCTGGGAGCCACCAAGG + Intronic
1151091311 17:71443166-71443188 TTAAGGCCTGGCATCCATTAAGG + Intergenic
1151689630 17:75674088-75674110 TAAAGGCCTGGCAGCCACTGGGG - Intronic
1151757731 17:76084133-76084155 TGAAGCCCTGGCCACCAAAAAGG + Exonic
1151820823 17:76495897-76495919 TGAAACCCTGGCAGTCACTGGGG - Intronic
1157502039 18:48197812-48197834 TGAAGCCCTAGCTCCCAATATGG - Intronic
1159623181 18:70662724-70662746 AGCATCCCTTGCAGCCAATAAGG - Intergenic
1161116707 19:2501053-2501075 TGGAGCCCAGGCAGCCAATGAGG - Intergenic
1163567108 19:18058388-18058410 GAGACCCCTGGCAGCCAATAGGG - Intergenic
926363634 2:12113368-12113390 GCAAGCCCTGGCAGTCAATGGGG + Intergenic
926954072 2:18274349-18274371 TGAAGCCCTAACACCCAGTATGG + Intronic
929768502 2:44870917-44870939 TACAGCCCTGGTAGCCAATGTGG + Intergenic
929911306 2:46091493-46091515 TGAAGGCTTGGCAGCCAGGAAGG + Intronic
930085304 2:47492957-47492979 TGAAGCCCTGGCAGTCATCTTGG - Intronic
933504060 2:83155505-83155527 TGAAAGGCTGGCAGCCAATATGG + Intergenic
935034039 2:99351209-99351231 TGAAACCCAGTCAGCCAAAAAGG - Intronic
941103580 2:161325924-161325946 TGAAGCAGTGGTAGCCAGTAAGG + Intronic
944540295 2:200747810-200747832 TGAAGCCGGGGCAGGCAGTATGG + Intergenic
944754868 2:202750573-202750595 TGAAGCCCTAACTGCCAATGTGG - Intronic
945310969 2:208312891-208312913 TGAAACCGTGGGAGCCAAGAAGG - Intronic
948093552 2:235315620-235315642 TGTAGTCCTGTCACCCAATAAGG - Intergenic
948935299 2:241160072-241160094 TGATGCCCTGGCTCCCAGTATGG - Intronic
1172520340 20:35561851-35561873 TCAAGCCTCGGCAGCCAATCAGG - Intergenic
1175537334 20:59723950-59723972 TGCAGACCAGGCAGCCAACATGG - Intronic
1175841142 20:62028222-62028244 AGAAGCCCTGGTAGGCAAAAAGG - Intronic
1180096392 21:45557194-45557216 TGAAGCCCTGGCAGCAGGAAGGG + Intergenic
1181636462 22:24176976-24176998 TGCAGGCCTGGCAGCCTCTAGGG - Intronic
1183188432 22:36305964-36305986 GGAAGCCCTGGCGGCAGATACGG + Exonic
1183676915 22:39304326-39304348 TGCAGGCCTGGCAGCCAGCAGGG - Intergenic
949617481 3:5770055-5770077 TGAACCCATGGCAGCCTCTAGGG + Intergenic
951910753 3:27748042-27748064 TGAAGTACAGGCAGCCAGTAAGG + Intergenic
953237245 3:41117569-41117591 TGAAGCCCTGGCGGCCAGCCAGG - Intergenic
954141134 3:48606393-48606415 TGTTGCCTTGGCACCCAATAAGG + Intronic
954400583 3:50317544-50317566 TGACTCCCTTGCAACCAATACGG + Intergenic
962853663 3:139326117-139326139 TGAAGCCCTAACACCCAATGTGG + Intronic
964219446 3:154327021-154327043 TGAAGCCCTAACTCCCAATATGG + Intergenic
964934974 3:162072982-162073004 TGAGACCCTGGGAGACAATAGGG + Intergenic
966048777 3:175587946-175587968 TCAATCACTGGAAGCCAATATGG + Intronic
969539496 4:7778083-7778105 TGAAGGCCTGGCACCCACTCTGG + Intronic
970419633 4:15893394-15893416 TGAAGCCTTGGCCCCCAATGTGG + Intergenic
971064729 4:23018076-23018098 TGAAGCCTGGGCAGCACATATGG + Intergenic
972280067 4:37593435-37593457 TGAAGCCACAGCAGCCATTATGG - Intronic
980590985 4:134888454-134888476 TGCAGCTCTGGCAGTCAATAAGG - Intergenic
982754564 4:159202913-159202935 TGAGGCCCAGTCAGCCAAAAAGG - Intronic
983302681 4:165947326-165947348 TGAAGCCCTAACATCCAATGTGG - Intronic
984597757 4:181690058-181690080 TGATTCCCAGGCACCCAATATGG + Intergenic
986646771 5:9924412-9924434 TGAAGGCCTGAAAGTCAATAGGG - Intergenic
989107010 5:37872571-37872593 TGGAGCTCTGGCAGCCATTTTGG + Intergenic
990623575 5:57586947-57586969 TGTAGTCATGGCAGCCAAGAAGG - Intergenic
995394912 5:111677175-111677197 TGAAGTGCTGGCAGACAAGATGG + Intronic
998727334 5:145032546-145032568 TGATTCCCTGTCAGCCAATTAGG + Intergenic
1000436786 5:161220815-161220837 TGAAGGCCTGGCAACCAAAAAGG - Intergenic
1002322384 5:178383501-178383523 TGCAGGCCTGGCACCCAATTTGG + Intronic
1002698577 5:181106770-181106792 TCAAGACCAGCCAGCCAATATGG - Intergenic
1004787331 6:18983760-18983782 TGTAGTGCTGGCTGCCAATAAGG + Intergenic
1008428722 6:51389575-51389597 TGGAGCCCTGGATGCCAATGGGG - Intergenic
1009527922 6:64770545-64770567 AGAAGCACTGGCAACCATTATGG - Intronic
1011913430 6:92470957-92470979 TGAATCTCAGGCAGCCAAGAAGG - Intergenic
1012791846 6:103708719-103708741 TCCAGCCCCTGCAGCCAATATGG + Intergenic
1021984914 7:26089083-26089105 TGAAGGCCTGGAGACCAATATGG + Intergenic
1022692611 7:32671387-32671409 AGAAGAACTGGCAGCCAGTAGGG + Intergenic
1024317517 7:48035443-48035465 TGGAGCACTGTCAGCCAATAGGG - Intergenic
1024531913 7:50400504-50400526 GGAAGCCGTGGCAGCCCATGTGG - Exonic
1025158446 7:56631068-56631090 TGAAGCCCTTGCAGGCAGAAGGG + Intergenic
1027874298 7:83749360-83749382 TGAATAGCTGGCAGCCAAGATGG - Intergenic
1030658497 7:112194064-112194086 TGAAGCCCTAACTCCCAATATGG - Intronic
1034944504 7:155253311-155253333 TGAGGCCCAGGCAGCCACCAGGG + Intergenic
1042600320 8:70493229-70493251 TGAAGCGCTGGGAGCCAAGTGGG + Intergenic
1043406326 8:79938094-79938116 TGAAGACCTGTCAACAAATAAGG + Intronic
1043420051 8:80088678-80088700 TGAAGCCCTAACTCCCAATATGG + Intronic
1044782821 8:95761017-95761039 TGTATTCCTGGCAGCCAGTATGG - Intergenic
1044795241 8:95890451-95890473 TGAATCCCTGGCTACAAATAAGG + Intergenic
1046814496 8:118569532-118569554 TGAAGCCCTAACCCCCAATAAGG + Intronic
1047493799 8:125395426-125395448 TGAGGCCCTGGCAGCAGGTAGGG + Intergenic
1047560110 8:125978010-125978032 TTAAGCTCTGGCAGGCAATTAGG + Intergenic
1048771420 8:137899292-137899314 TGAAGCCTGGGCAGCCCAAAGGG + Intergenic
1050100836 9:2117811-2117833 TGACACACTGGCAGCCAAGAAGG - Intronic
1051138508 9:13951496-13951518 TGGAGTCCTGGCAGCCATTTTGG - Intergenic
1053753443 9:41279081-41279103 TGAAACCCTGGAAGACAATTTGG - Intergenic
1054258967 9:62843444-62843466 TGAAACCCTGGAAGACAATTTGG - Intergenic
1054332812 9:63776596-63776618 TGAAACCCTGGAAGACAATTTGG + Intergenic
1056170481 9:83980265-83980287 TGAAGCCCTGGCAGCCAATAGGG - Exonic
1056941995 9:90963890-90963912 TGTAGCCATTGTAGCCAATATGG - Intergenic
1057037420 9:91821455-91821477 GGAAGACCAGGCAGCCAATGTGG - Intronic
1057532041 9:95857457-95857479 TGAAATTCTGGCAGCCAATAGGG - Intergenic
1059281201 9:113135755-113135777 AGAAGCCCTGCCAGCCAGCAAGG + Intergenic
1060816059 9:126635902-126635924 TGAAGGCCTGGCAGCCCACAGGG - Intronic
1061324445 9:129854915-129854937 TGGAGGCCTGGGAGCCAACATGG + Intronic
1061398927 9:130357955-130357977 TGTAGCCCTGGCAGCCTTTGGGG + Intronic
1202799811 9_KI270719v1_random:164907-164929 TGAAACCCTGGAAGACAATTTGG + Intergenic
1185717280 X:2353000-2353022 GGAAGCCATGGCAGGCAAGATGG + Intronic
1191952791 X:66611994-66612016 AGAAGCCATGGAAGCCAAGAAGG + Intronic
1192964053 X:76159017-76159039 TGGAGCCCTGGCTGGCAAGATGG + Intergenic
1197772664 X:130099238-130099260 TGGAGCCCTGATAGCCACTATGG - Intronic
1199608100 X:149592733-149592755 TGCAGCCCCAGCAGCCACTAGGG + Exonic
1199631020 X:149776627-149776649 TGCAGCCCCAGCAGCCACTAGGG - Exonic