ID: 1056170484

View in Genome Browser
Species Human (GRCh38)
Location 9:83980277-83980299
Sequence TCGCACCATCGCTGAAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056170484_1056170494 23 Left 1056170484 9:83980277-83980299 CCAGGGCTTCAGCGATGGTGCGA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1056170494 9:83980323-83980345 CACGTCAATCAAGGCGACGGAGG 0: 1
1: 0
2: 0
3: 0
4: 76
1056170484_1056170495 26 Left 1056170484 9:83980277-83980299 CCAGGGCTTCAGCGATGGTGCGA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1056170495 9:83980326-83980348 GTCAATCAAGGCGACGGAGGAGG 0: 1
1: 0
2: 0
3: 0
4: 41
1056170484_1056170492 20 Left 1056170484 9:83980277-83980299 CCAGGGCTTCAGCGATGGTGCGA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1056170492 9:83980320-83980342 GGCCACGTCAATCAAGGCGACGG 0: 1
1: 0
2: 0
3: 0
4: 20
1056170484_1056170487 -8 Left 1056170484 9:83980277-83980299 CCAGGGCTTCAGCGATGGTGCGA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36
1056170484_1056170488 -1 Left 1056170484 9:83980277-83980299 CCAGGGCTTCAGCGATGGTGCGA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1056170484_1056170489 14 Left 1056170484 9:83980277-83980299 CCAGGGCTTCAGCGATGGTGCGA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1056170489 9:83980314-83980336 GCCCGAGGCCACGTCAATCAAGG 0: 1
1: 0
2: 1
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056170484 Original CRISPR TCGCACCATCGCTGAAGCCC TGG (reversed) Intronic
900162556 1:1231353-1231375 TTCCACCAGAGCTGAAGCCCAGG - Intronic
902325840 1:15700161-15700183 GAGCCCCATCGCTGAAGCCCTGG + Intronic
902973101 1:20069566-20069588 TGGGAGGATCGCTGAAGCCCAGG + Intronic
905941144 1:41864387-41864409 TCTCACCATTTCTAAAGCCCCGG + Intronic
913230780 1:116739363-116739385 TCTGATCATCACTGAAGCCCTGG + Intergenic
915093768 1:153444775-153444797 TCTCACCTTCCCTGAAGCCCCGG + Intergenic
915142274 1:153775162-153775184 TCGCGCCTTCCCTGAATCCCAGG - Intronic
915482004 1:156193324-156193346 CCGCAGCATCGCTTGAGCCCAGG + Intergenic
917200374 1:172508362-172508384 TCACATCTTAGCTGAAGCCCGGG + Intergenic
918236415 1:182584751-182584773 CCTAATCATCGCTGAAGCCCTGG + Intronic
923866686 1:237947217-237947239 ACTCACCATCGCGGAAGGCCTGG - Intergenic
1062873144 10:924149-924171 TGGCAAGATCGCTCAAGCCCAGG + Intronic
1067050840 10:43019351-43019373 TGGGAGCATCGCTTAAGCCCAGG + Intergenic
1083587037 11:63867744-63867766 TCTCACCATGGCTGACGCCGTGG + Intronic
1083610221 11:64000780-64000802 TCGCACCGACGCTGAGGCCCGGG - Intronic
1087328188 11:96748484-96748506 TCGCCCCATAGTTGCAGCCCAGG - Intergenic
1091383664 12:78345-78367 TCGCACCATCACACTAGCCCCGG - Intronic
1095091362 12:38109828-38109850 TCGGAGGATCACTGAAGCCCAGG - Intergenic
1099516776 12:83606385-83606407 TTAAACCATCCCTGAAGCCCTGG - Intergenic
1103814716 12:123645161-123645183 TGGCAGGATCGCTTAAGCCCTGG - Intronic
1109220527 13:59636750-59636772 TTGCACCATCCCTGTAGCTCAGG + Intergenic
1115396843 14:32918423-32918445 TCTCATCATCTCTGAAGCTCAGG - Intergenic
1119743678 14:77029291-77029313 TAGCTCTATCGTTGAAGCCCGGG - Intergenic
1133181993 16:4063479-4063501 TGGGACGATCGCTCAAGCCCAGG + Intronic
1133331069 16:4974429-4974451 TCGGAGAATCGCTTAAGCCCAGG - Intronic
1142685901 17:1576791-1576813 TGGCACCAACGGTGCAGCCCGGG - Intronic
1146283077 17:31557984-31558006 TGGGAGGATCGCTGAAGCCCAGG - Intergenic
1147710706 17:42462120-42462142 TGGGAGGATCGCTGAAGCCCAGG + Intronic
1148609751 17:48956865-48956887 TGGCAAGATCGCTTAAGCCCAGG + Intergenic
1152577192 17:81147661-81147683 TCGGAGGATCGCTTAAGCCCAGG + Intronic
1155550572 18:26960761-26960783 TGGCAGAATTGCTGAAGCCCAGG - Intronic
1156634527 18:39011350-39011372 TCCCACTATCTCTGATGCCCAGG - Intergenic
1158568543 18:58576327-58576349 TCGTACCATTGCTCCAGCCCAGG + Intronic
1160065175 18:75567452-75567474 TCCCAAGATCGCTGAAGCCAAGG - Intergenic
1160510681 18:79451846-79451868 TCCCACCAGCGCCGAAGCCCAGG - Intronic
1161519904 19:4718145-4718167 TGGCAGGATCGCTGGAGCCCAGG - Intronic
1163038103 19:14583293-14583315 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163038792 19:14587550-14587572 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163039538 19:14592217-14592239 TCCCTCCATCCCTCAAGCCCTGG - Intronic
925938660 2:8793401-8793423 TGGGAGCATCGCTTAAGCCCAGG + Intronic
927476971 2:23420904-23420926 TCACACCCTCCCAGAAGCCCTGG + Intronic
929104743 2:38353761-38353783 TCACATCATCACTGAAGCACTGG + Intronic
930321818 2:49864602-49864624 TGGCAACCTCGCTGATGCCCAGG + Intergenic
932622318 2:73272152-73272174 TCCCACCATCCCTGGAGCTCAGG + Intronic
932711054 2:74063254-74063276 TCCCACCGTTGGTGAAGCCCAGG + Intronic
932865178 2:75334188-75334210 TCTCCCCATGGCTGAAGGCCAGG + Intergenic
933063565 2:77768048-77768070 TGCCACCATCGATGATGCCCAGG - Intergenic
937778628 2:125811173-125811195 ACTCACCATCGCGGAAGGCCTGG + Intergenic
945063075 2:205925322-205925344 TGGGACGATCGCTGGAGCCCAGG + Intergenic
945373759 2:209054326-209054348 TTGAACCATCCCTGAATCCCTGG - Intergenic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948093498 2:235315171-235315193 TGGCACAATCGCTTGAGCCCAGG + Intergenic
948637087 2:239345468-239345490 TGGGAGGATCGCTGAAGCCCAGG + Intronic
1170607890 20:17887454-17887476 TAGCACCATCTCTGAGGCCACGG + Intergenic
1171277334 20:23869068-23869090 TGGCAACATGGCTGAATCCCTGG - Intergenic
1172278202 20:33692379-33692401 TCCCACCTTCGCTGTGGCCCTGG - Intergenic
1173489324 20:43467010-43467032 TGGGACGATCGCTGGAGCCCAGG - Intergenic
1173737850 20:45374362-45374384 TCGGAGGATCGCTTAAGCCCAGG - Intronic
1174666365 20:52261676-52261698 TCGCATCATCATTGGAGCCCTGG - Intergenic
1175495770 20:59413204-59413226 TCCCACCCTCCCTGAGGCCCTGG + Intergenic
1175781974 20:61688597-61688619 TCGCAGCATCTCTGCAGCTCCGG + Intronic
1175995695 20:62811413-62811435 AGGCACCATCCCTGAAGCCCCGG - Intronic
1176075853 20:63247920-63247942 CCCCACCATGGCTGGAGCCCTGG - Intronic
1176281491 20:64316373-64316395 TCGCACCATCACACTAGCCCCGG + Intergenic
1177831370 21:26142674-26142696 TGGCAGCATCGCTTGAGCCCAGG + Intronic
1180612709 22:17108331-17108353 TCCCCCCACCGCTGAAGCCCAGG + Exonic
1180758904 22:18183821-18183843 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1180769191 22:18367612-18367634 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1180777121 22:18494783-18494805 TCCCACCCTAGCTGAAGCCATGG - Intergenic
1180809841 22:18752092-18752114 TCCCACCCTAGCTGAAGCCATGG - Intergenic
1180827063 22:18870841-18870863 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1181195984 22:21186344-21186366 TCCCACCCTAGCTGAAGCCATGG - Intergenic
1181213544 22:21306780-21306802 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1181524231 22:23470091-23470113 TCCCACCCCAGCTGAAGCCCGGG + Intergenic
1184767182 22:46577850-46577872 TGGCACCTTGGCTGTAGCCCAGG + Intronic
1203230815 22_KI270731v1_random:108497-108519 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1203277208 22_KI270734v1_random:96746-96768 TCCCACCCTAGCTGAAGCCATGG + Intergenic
950635788 3:14313545-14313567 TCTCACCATCTCTTAAGACCAGG + Intergenic
956183057 3:66535218-66535240 TGGGAGGATCGCTGAAGCCCAGG - Intergenic
960237563 3:115301518-115301540 TGGGAGGATCGCTGAAGCCCAGG - Intergenic
974079393 4:57196583-57196605 TGGCAGGATCGCTTAAGCCCAGG - Intergenic
975801337 4:78061507-78061529 TCCCACAAACGCTGAATCCCGGG + Intronic
976723389 4:88192443-88192465 TCGCTCCATCGCCCAGGCCCAGG + Intronic
977720649 4:100236406-100236428 TAGGACAATTGCTGAAGCCCAGG - Intergenic
984751930 4:183286387-183286409 TCCCACAATCGCTCAAGACCTGG - Intronic
985159393 4:187028561-187028583 TGGCACCATCGCTGAGCTCCAGG - Intergenic
988504658 5:31811378-31811400 TTACACCATCACTGCAGCCCTGG - Intronic
991371080 5:65920614-65920636 TGGCACAATCGCTGGAGCCCAGG + Intergenic
997643373 5:135464308-135464330 TCGCAGCATGGCTGGAGCACGGG - Intergenic
999287943 5:150405308-150405330 TCCCATCATGGCTGAAGTCCAGG - Intronic
999297107 5:150466509-150466531 TAGGAGCATTGCTGAAGCCCAGG + Intergenic
1003232248 6:4264985-4265007 GTGCACCATCTCTGAAGCCTGGG + Intergenic
1003954334 6:11147980-11148002 TTGCACCATCGCTGCAGTGCAGG - Intergenic
1006937243 6:37727032-37727054 TGGGAGCATCGCTTAAGCCCGGG + Intergenic
1007968195 6:46023418-46023440 TCCCTCCATTGCTAAAGCCCAGG + Intronic
1012499581 6:99874228-99874250 TCTCACCATCCCTGAGGGCCAGG - Intergenic
1016794684 6:148105393-148105415 TGGCAGGATCGCTCAAGCCCAGG - Intergenic
1017097645 6:150818983-150819005 TCCCACCATCGCTGCAGCTGAGG + Intronic
1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG + Intronic
1022227670 7:28380436-28380458 TAGCACCATCGCAGCAGACCTGG - Intronic
1022491583 7:30824664-30824686 TGGGAGGATCGCTGAAGCCCAGG - Intronic
1026486833 7:70829244-70829266 TCACACCATCGCCCAAGCCTTGG - Intergenic
1026619841 7:71940694-71940716 TCGCAGGATCGCTTGAGCCCTGG - Intronic
1029085990 7:98012187-98012209 TGGGAGGATCGCTGAAGCCCAGG - Intergenic
1029658348 7:101942553-101942575 TGGGAGGATCGCTGAAGCCCAGG - Intronic
1033380732 7:140815476-140815498 TCGCACCATTGCACAAGCCTGGG - Intronic
1034901495 7:154910480-154910502 GTGCACCATCCCTGCAGCCCAGG + Intergenic
1035590765 8:811575-811597 TCTCACCATGGCAGGAGCCCTGG - Intergenic
1036699689 8:11004088-11004110 TCGCTCCATCTCTGCAGCTCAGG - Intronic
1037416702 8:18659084-18659106 TCGGCCCATCTCTGAAGCCAAGG + Intronic
1039250431 8:35658393-35658415 TTGCACCATCTTTGAAGCCAGGG + Intronic
1040377106 8:46836782-46836804 ACTCACCATCGCGGACGCCCTGG - Intergenic
1044019393 8:87085832-87085854 AAGTACCATCTCTGAAGCCCAGG - Intronic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056804538 9:89718424-89718446 TTGCACCCTCGCTGAAGACAAGG + Intergenic
1059062685 9:111050055-111050077 AGGCAGCATCGCTGGAGCCCGGG + Intergenic
1060994838 9:127870052-127870074 TCCCTCCTTCGGTGAAGCCCTGG + Intronic
1195819925 X:108933519-108933541 TCGAACCATCCCTGTATCCCAGG + Intergenic