ID: 1056170487

View in Genome Browser
Species Human (GRCh38)
Location 9:83980292-83980314
Sequence TGGTGCGAGGGCGAAGCGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 36}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056170475_1056170487 17 Left 1056170475 9:83980252-83980274 CCCCGCCGTCGCGCCCTATTGGC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36
1056170477_1056170487 15 Left 1056170477 9:83980254-83980276 CCGCCGTCGCGCCCTATTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36
1056170482_1056170487 3 Left 1056170482 9:83980266-83980288 CCTATTGGCTGCCAGGGCTTCAG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36
1056170478_1056170487 12 Left 1056170478 9:83980257-83980279 CCGTCGCGCCCTATTGGCTGCCA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36
1056170473_1056170487 20 Left 1056170473 9:83980249-83980271 CCTCCCCGCCGTCGCGCCCTATT 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36
1056170484_1056170487 -8 Left 1056170484 9:83980277-83980299 CCAGGGCTTCAGCGATGGTGCGA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36
1056170481_1056170487 4 Left 1056170481 9:83980265-83980287 CCCTATTGGCTGCCAGGGCTTCA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36
1056170476_1056170487 16 Left 1056170476 9:83980253-83980275 CCCGCCGTCGCGCCCTATTGGCT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG 0: 1
1: 0
2: 0
3: 5
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056170487 Original CRISPR TGGTGCGAGGGCGAAGCGAT TGG Intronic
921830666 1:219724557-219724579 TTGTGGGAGGGCGCAGCAATTGG - Intronic
1065186151 10:23172754-23172776 TGGTGCCAGGGAGAAGCGCAGGG + Intergenic
1069681684 10:70290116-70290138 AGGTGGGAGGGAGAAGCGGTAGG - Intergenic
1072043438 10:91631363-91631385 TGGGGCTAGGGCCAAGGGATGGG + Intronic
1072322198 10:94261622-94261644 TGGTGCGAATGTGAAGCAATTGG + Intronic
1073388237 10:103146827-103146849 TAGTGCGAGGGCAGAGCAATTGG - Intronic
1074147688 10:110730947-110730969 TGGGGCCAGTACGAAGCGATTGG - Intronic
1074572664 10:114638528-114638550 TGGTGAGAGGCCAAAGCCATGGG + Intronic
1080553240 11:33392623-33392645 TGGGGCGAGTGAGAAGAGATGGG - Intergenic
1101135456 12:101739137-101739159 TGGTCCCAGGGTGTAGCGATGGG + Intronic
1107037993 13:35920818-35920840 TGGTGACAGGGAGAAGCAATTGG - Intronic
1117232805 14:53738824-53738846 TGGTGTGAGGGAGAAGGAATCGG - Intergenic
1123534818 15:21174868-21174890 TGGGGCGAGGGCGCAGCGCCGGG - Intergenic
1136554083 16:30997580-30997602 GGGAGAGAGGGCGCAGCGATGGG + Intronic
1144650570 17:17004471-17004493 TGCTGCGAGAGGAAAGCGATAGG - Intergenic
1144726134 17:17503684-17503706 TGGTGTGAGGGTGAAGCGCAGGG + Intergenic
1148755288 17:49969882-49969904 TGGGGGGAGGGCGAAGGGATGGG + Intronic
947677158 2:231992619-231992641 AGGTGCAAGGGGGAAGCAATGGG - Intronic
1176003176 20:62843433-62843455 GGGTGGGAGGGCGAGGGGATAGG + Intronic
1176515087 21:7777823-7777845 TGGTGCCAGGCAGAAGCAATTGG - Intergenic
1176681229 21:9820361-9820383 TGGGGCGACGGCGAAACGAAGGG + Intergenic
1178649115 21:34407835-34407857 TGGTGCCAGGCAGAAGCAATTGG - Intronic
1181247516 22:21513244-21513266 TGGTGAGAGGGCACAGGGATGGG - Intergenic
952225882 3:31375367-31375389 TGGTGCCATGGAGAAGCGGTTGG - Intergenic
954384217 3:50236049-50236071 TGGCTCGAGGGCGGAGCGAAGGG - Exonic
954796355 3:53163146-53163168 TGGTGTGAGGGCTATGCGATGGG + Intronic
961201035 3:125045533-125045555 TGGTGGGAGGCAGAAGAGATGGG + Intronic
987056022 5:14192515-14192537 TGGTGAGAGGCCGAAGCGGGAGG - Intronic
990104883 5:52246266-52246288 TGGGGGGAGGGGGAAGGGATAGG + Intergenic
997479048 5:134169295-134169317 TGGTGGGAGGGAGAAGAGAGGGG - Intronic
1018698981 6:166412330-166412352 CAGTGCGAGGGCGCAGCCATTGG - Exonic
1037794840 8:21984459-21984481 TGATGCTAGGGCGAAGACATTGG + Intronic
1040054007 8:43041881-43041903 AGTTGCTAGGGGGAAGCGATGGG - Intronic
1041785069 8:61622683-61622705 TGGTGCAAGGTGGAAGCCATTGG - Intronic
1045023455 8:98064293-98064315 GGGGGCGAGGGCGAAGCGCTGGG - Exonic
1045477073 8:102562181-102562203 TTTTGCGAGGCCGAAGCGAACGG - Intergenic
1056170487 9:83980292-83980314 TGGTGCGAGGGCGAAGCGATTGG + Intronic
1203665821 Un_KI270754v1:20082-20104 TGGGGCGACGGCGAAGCGAAGGG + Intergenic
1203666967 Un_KI270754v1:25720-25742 CGGGGCGACGGCGAAGCGAAGGG + Intergenic
1203668115 Un_KI270754v1:31359-31381 CGGGGCGACGGCGAAGCGAAGGG + Intergenic
1203669253 Un_KI270754v1:36996-37018 TGGGGCGACGGCGAAGCGAAGGG + Intergenic
1203669828 Un_KI270754v1:39812-39834 TGGGGCGACGGCGAAACGAAGGG + Intergenic