ID: 1056170488

View in Genome Browser
Species Human (GRCh38)
Location 9:83980299-83980321
Sequence AGGGCGAAGCGATTGGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056170481_1056170488 11 Left 1056170481 9:83980265-83980287 CCCTATTGGCTGCCAGGGCTTCA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1056170484_1056170488 -1 Left 1056170484 9:83980277-83980299 CCAGGGCTTCAGCGATGGTGCGA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1056170475_1056170488 24 Left 1056170475 9:83980252-83980274 CCCCGCCGTCGCGCCCTATTGGC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1056170476_1056170488 23 Left 1056170476 9:83980253-83980275 CCCGCCGTCGCGCCCTATTGGCT 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1056170482_1056170488 10 Left 1056170482 9:83980266-83980288 CCTATTGGCTGCCAGGGCTTCAG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1056170473_1056170488 27 Left 1056170473 9:83980249-83980271 CCTCCCCGCCGTCGCGCCCTATT 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1056170478_1056170488 19 Left 1056170478 9:83980257-83980279 CCGTCGCGCCCTATTGGCTGCCA 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1056170477_1056170488 22 Left 1056170477 9:83980254-83980276 CCGCCGTCGCGCCCTATTGGCTG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056170488 Original CRISPR AGGGCGAAGCGATTGGCCCG AGG Intronic
902509163 1:16956200-16956222 AAGGGGGAGCTATTGGCCCGGGG - Intronic
903857788 1:26346806-26346828 AAGGCCAAGCGATTTGCCTGAGG - Intronic
906525333 1:46490262-46490284 AGGACGAAGGCCTTGGCCCGCGG + Intergenic
913331418 1:117671236-117671258 AGGGGGAAGGGACTGGCCCAGGG + Intergenic
913563396 1:120046379-120046401 AGTGCGAAGTGATTGGCCCTTGG - Intronic
913634727 1:120747198-120747220 AGTGTGAAGTGATTGGCCCTTGG + Intergenic
914283990 1:146205743-146205765 AGTGCGAAGTGATTGGCCCTTGG - Intronic
914545021 1:148656482-148656504 AGTGCGAAGTGATTGGCCCTTGG - Intronic
914621546 1:149414206-149414228 AGTGCGAAGTGATTGGCCCTTGG + Intergenic
1064012011 10:11742796-11742818 AGGGCGCCGCCATTGACCCGGGG + Intronic
1066105405 10:32152004-32152026 AGGCCATAGCGATTGGCCCAGGG + Intergenic
1073139367 10:101237299-101237321 AGGGCGGAGGTCTTGGCCCGAGG - Intergenic
1092029716 12:5274191-5274213 AGGGGGAAGCGACTTGCCCAGGG + Intergenic
1092229225 12:6767456-6767478 AGGGCGAACGGATGGGGCCGGGG - Intronic
1101606170 12:106248467-106248489 AGGGGGTCGCGCTTGGCCCGCGG - Intronic
1111950868 13:94708100-94708122 AGGGCGTAGAGAAAGGCCCGGGG - Intergenic
1114516161 14:23301608-23301630 AAGGCGAAGCGGTCGGCGCGCGG + Exonic
1134655958 16:15948993-15949015 AAGGCGAAGTGACTTGCCCGAGG - Intergenic
1135915208 16:26599424-26599446 AGGGCGAAGTCATTGGACAGGGG + Intergenic
1136913181 16:34160333-34160355 GGGGGCATGCGATTGGCCCGAGG - Intergenic
1138394809 16:56695694-56695716 AGGGCACACCGATTGGCCCATGG - Intronic
1142261036 16:89042540-89042562 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261046 16:89042573-89042595 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261056 16:89042606-89042628 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261066 16:89042639-89042661 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1142261076 16:89042672-89042694 AGGGTGCAGCGATGGGCGCGGGG + Intergenic
1156845871 18:41664739-41664761 AGGGCCAAGCTCTTGGCACGCGG + Intergenic
1161700829 19:5794180-5794202 AGAGGGAAGGGATTTGCCCGAGG + Intergenic
1167766389 19:51485507-51485529 AGGGAGAAGAGATTGGGCAGTGG + Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
937868102 2:126768949-126768971 AGGGTGAAAGAATTGGCCCGAGG + Intergenic
945216021 2:207434936-207434958 AGGACTAAGCGACTGGCCCAAGG + Intergenic
947754384 2:232550954-232550976 AGGGCGAAGAGCTGGGCCCGGGG + Intronic
1172409037 20:34709066-34709088 AGGGCGAGACGCCTGGCCCGTGG + Intronic
1172751040 20:37251453-37251475 AAGGCGAAGTGACTGGCCCAGGG - Intronic
1175421791 20:58839548-58839570 TGGGCGAAGCGATGGGCGGGGGG - Intergenic
1181764099 22:25078953-25078975 AGGGCTAAGAGATTTGCTCGAGG - Intronic
961734802 3:128994630-128994652 GAGGTGAAGCGATTCGCCCGAGG + Intronic
962853434 3:139324840-139324862 AGGGCTAAGGGATGGGCCCAGGG + Intronic
963138371 3:141928457-141928479 AGGGCTATGCCATTGGCCCTTGG + Intergenic
980880635 4:138706858-138706880 TGGGTGAAGAGATTTGCCCGAGG - Intergenic
994733243 5:103519753-103519775 AGGGAGAAGCAATTGACCAGTGG - Intergenic
1001826807 5:174751739-174751761 AGGGCGGCGCGACCGGCCCGGGG + Intergenic
1008489091 6:52066654-52066676 AGGCCGAAGCGAGTGGCAGGTGG + Intronic
1019809317 7:3152898-3152920 GGGGCTAAGCGATTTGCCCAAGG + Intronic
1036613498 8:10370648-10370670 AGAGCAAAGTGGTTGGCCCGAGG - Intronic
1038447850 8:27616047-27616069 AGGGCAAAGTGATTAGTCCGAGG - Intergenic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1061872390 9:133527906-133527928 CAGGGGAAGCGATTGGCCTGGGG + Intronic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1190643578 X:52503970-52503992 AGGGAGAAGCGATTCTCTCGTGG + Intergenic
1197760423 X:130024235-130024257 AGGGGGAAGCGCTTGCCCAGCGG + Intronic
1200208055 X:154332240-154332262 AGGGCGAGGGGACTGGCCAGAGG - Intergenic