ID: 1056170489

View in Genome Browser
Species Human (GRCh38)
Location 9:83980314-83980336
Sequence GCCCGAGGCCACGTCAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056170482_1056170489 25 Left 1056170482 9:83980266-83980288 CCTATTGGCTGCCAGGGCTTCAG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1056170489 9:83980314-83980336 GCCCGAGGCCACGTCAATCAAGG 0: 1
1: 0
2: 1
3: 1
4: 31
1056170484_1056170489 14 Left 1056170484 9:83980277-83980299 CCAGGGCTTCAGCGATGGTGCGA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1056170489 9:83980314-83980336 GCCCGAGGCCACGTCAATCAAGG 0: 1
1: 0
2: 1
3: 1
4: 31
1056170481_1056170489 26 Left 1056170481 9:83980265-83980287 CCCTATTGGCTGCCAGGGCTTCA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1056170489 9:83980314-83980336 GCCCGAGGCCACGTCAATCAAGG 0: 1
1: 0
2: 1
3: 1
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056170489 Original CRISPR GCCCGAGGCCACGTCAATCA AGG Intronic
908082602 1:60597465-60597487 GGCCCAGTCCACGGCAATCATGG + Intergenic
1064141959 10:12798134-12798156 GCCTGAAGCCACGCCATTCAGGG - Intronic
1067400971 10:45972939-45972961 TCGCGAGTCCAGGTCAATCACGG - Intronic
1067869324 10:49942510-49942532 TCGCGAGTCCAGGTCAATCACGG - Intronic
1069857058 10:71447175-71447197 GCCAGAGGCCAAGTGCATCAGGG + Intronic
1076010475 10:126984129-126984151 AACAGAGGCCATGTCAATCAGGG - Intronic
1102158198 12:110747173-110747195 GCCAGAGGCCAGATCACTCAGGG + Intergenic
1102865388 12:116370050-116370072 GCCAGAGGCCACGTCACATAAGG + Intergenic
1113091435 13:106620680-106620702 GCCCAAGGCCACATGAGTCAGGG - Intergenic
1121916635 14:97841637-97841659 GCCTGAGGACACTTCAAGCAAGG - Intergenic
1122163719 14:99805150-99805172 GCCCCAGGCCACGTGTCTCAGGG + Intronic
1141761040 16:86028932-86028954 GCCCGAGGCCACGTTCCTCGAGG + Intergenic
1161537053 19:4826076-4826098 GCCTGAGGCCAGGAGAATCAAGG + Intronic
1162898293 19:13778513-13778535 ACGCCAGGCCACGTCACTCATGG - Intergenic
936433418 2:112482925-112482947 GCCCGCGCCCACGCCAAGCAGGG - Intronic
948832778 2:240606330-240606352 GCCCGATGTCACGTCCATCCAGG - Intronic
1173660025 20:44726999-44727021 GCCAGCGGCCACGGCAATCTTGG - Intronic
1175107523 20:56625853-56625875 GCCCGGGTCCACGTCAGTCCCGG - Intergenic
1180206553 21:46264763-46264785 CCCCGAGGCCACGCCTATCAGGG + Intronic
1180225878 21:46391980-46392002 CCCCGAGGCCACGGCCATCCTGG - Intronic
956196647 3:66659603-66659625 GCCAAAGGCCAGGGCAATCATGG + Intergenic
1019214514 6:170434681-170434703 ACCTGGGGCCACGTCAATGAGGG + Intergenic
1019294378 7:266284-266306 GCCCGAGACCACGTCACAGAAGG + Intergenic
1019594925 7:1854104-1854126 GGCGGAGGCCACATCACTCACGG + Intronic
1024302645 7:47899513-47899535 GCCAGATGCCACCTCAAGCATGG + Intronic
1036774585 8:11601539-11601561 GCACGAGGCCACGGCAATCACGG + Intergenic
1041274402 8:56142466-56142488 GCCAGAGACCACCTGAATCATGG + Intergenic
1042503461 8:69535341-69535363 GCCCAACGCCAGGTCACTCAGGG - Intronic
1049492191 8:142911305-142911327 GCCCCAGGCCTCGTCTTTCATGG - Exonic
1056170489 9:83980314-83980336 GCCCGAGGCCACGTCAATCAAGG + Intronic
1056965312 9:91160028-91160050 GCCCCAGCCCACGTCCCTCACGG + Intergenic
1061971356 9:134047151-134047173 GCCCGAGATCCAGTCAATCAAGG + Intronic
1186486357 X:9937061-9937083 GGCAGGGGACACGTCAATCAGGG + Intronic
1200179487 X:154141572-154141594 GCCCAAGGCCAAGGCCATCAGGG + Intergenic