ID: 1056170492

View in Genome Browser
Species Human (GRCh38)
Location 9:83980320-83980342
Sequence GGCCACGTCAATCAAGGCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 20}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056170484_1056170492 20 Left 1056170484 9:83980277-83980299 CCAGGGCTTCAGCGATGGTGCGA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1056170492 9:83980320-83980342 GGCCACGTCAATCAAGGCGACGG 0: 1
1: 0
2: 0
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056170492 Original CRISPR GGCCACGTCAATCAAGGCGA CGG Intronic
904321106 1:29698316-29698338 GGCCACGTCCATCTAGACCAGGG - Intergenic
908014192 1:59814782-59814804 GGCCAGGTCACTCAGGGCGGCGG + Intronic
1070619475 10:77997306-77997328 GGCCAGGGCAATCAAGCAGAAGG + Intronic
1084755667 11:71237087-71237109 GGCCACATCAATAAACCCGAGGG + Intronic
1089577887 11:119459697-119459719 GGCCACATCATGCAAGCCGAGGG + Intergenic
1132224302 15:100128576-100128598 AGCCACGACTATCATGGCGAGGG + Intronic
1133345206 16:5065332-5065354 AGCCACCTCATTCAAGGGGAGGG + Intronic
1134207375 16:12249226-12249248 GGCCAACTCAATGAAGGCCAAGG + Intronic
1134365215 16:13570863-13570885 GGCCACGTGAAGCAAGGAAATGG + Intergenic
1152260244 17:79262898-79262920 GGCCACCTGAAACAAGGAGAAGG - Intronic
925988120 2:9232173-9232195 GGCCAGGTCAACAAAGGAGAAGG - Intronic
934053754 2:88233802-88233824 GGCCATGCCAATCCAGGCCATGG - Intergenic
1175791843 20:61744857-61744879 CGCCAGGACACTCAAGGCGAAGG - Intronic
952495109 3:33908983-33909005 AGCCATCTCCATCAAGGCGACGG - Intergenic
967858165 3:194134038-194134060 GGCCACATCAAACAAGACGCTGG + Intergenic
999279759 5:150357564-150357586 GGCCCCGCCCCTCAAGGCGAAGG - Intergenic
1006097485 6:31665247-31665269 GGCCACGTTGAGGAAGGCGAAGG - Intronic
1010289639 6:74120381-74120403 GGCCAGGGCAATCAAGGCAGGGG + Intergenic
1031936851 7:127743848-127743870 GGCCAAGGCAATCATGGCTATGG + Intronic
1056170492 9:83980320-83980342 GGCCACGTCAATCAAGGCGACGG + Intronic
1061624663 9:131834739-131834761 AGCCACGTCAAAGAAGGAGAAGG - Intergenic