ID: 1056170494

View in Genome Browser
Species Human (GRCh38)
Location 9:83980323-83980345
Sequence CACGTCAATCAAGGCGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056170484_1056170494 23 Left 1056170484 9:83980277-83980299 CCAGGGCTTCAGCGATGGTGCGA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1056170494 9:83980323-83980345 CACGTCAATCAAGGCGACGGAGG 0: 1
1: 0
2: 0
3: 0
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056170494 Original CRISPR CACGTCAATCAAGGCGACGG AGG Intronic
900254187 1:1688755-1688777 CACGTCCTGCAAGGAGACGGAGG + Intronic
900262903 1:1741697-1741719 CACGTCCTGCAAGGAGACGGAGG + Intronic
904528614 1:31154008-31154030 CACTTGAATCCAGGAGACGGAGG - Intergenic
915504032 1:156340911-156340933 CACTTGAATCAAGGAGACAGAGG - Intronic
915563770 1:156702686-156702708 CACTTGAATCCAGGAGACGGAGG + Intronic
924138523 1:240997738-240997760 CACGTGAATCCAGGAGACAGAGG + Intronic
1065859042 10:29855555-29855577 CACTTGAATCCAGGCGACAGAGG - Intergenic
1067288410 10:44924147-44924169 CATGTGGATCAAGGCGACTGTGG - Intronic
1073352848 10:102832155-102832177 CACTTGAACCAAGGCGGCGGAGG - Intronic
1074068151 10:110037519-110037541 CACTTGAATCTAGGAGACGGAGG + Intronic
1075487100 10:122831535-122831557 CATGTGAATCAAGGAGACTGCGG + Intergenic
1083830960 11:65233266-65233288 CACGTAAATCATGGTGGCGGTGG - Intergenic
1084530618 11:69725714-69725736 CACTTCAATCCAGGAGGCGGAGG + Intergenic
1084546180 11:69816244-69816266 CACATCAAGCCAGGGGACGGGGG - Intronic
1085857184 11:80188436-80188458 CAAGTCAATCAAGGCCACCAGGG - Intergenic
1087019195 11:93585437-93585459 CACTTGAATCCAGGAGACGGAGG + Intergenic
1088246192 11:107820396-107820418 CACTTTAATCAAGGAGACTGGGG + Intronic
1092223834 12:6733528-6733550 CACTTCAACCCAGGAGACGGAGG - Intergenic
1097671654 12:62546668-62546690 CACTTGAACCAAGGAGACGGAGG + Intronic
1100486741 12:95036592-95036614 CACTTGAATCCAGGAGACGGAGG - Intronic
1103550099 12:121730565-121730587 CACTTCAATCCAGGAGGCGGAGG + Intronic
1106814522 13:33392481-33392503 CACTTGAATCCAGGAGACGGAGG - Intergenic
1110230484 13:73162493-73162515 CACTTGAATCCAGGAGACGGAGG + Intergenic
1119333355 14:73811974-73811996 CACGTGAATCCAGGAGGCGGAGG + Intergenic
1119688090 14:76648886-76648908 CACTTGAATCCAGGAGACGGAGG + Intergenic
1126589188 15:50322460-50322482 CACTTGAATCAAGGAGATGGAGG + Intronic
1130403270 15:83576992-83577014 CACTTGAACCAAGGAGACGGAGG - Intronic
1134507140 16:14817244-14817266 CACTTGAATCCAGGAGACGGCGG - Intronic
1134694840 16:16216001-16216023 CACTTGAATCCAGGAGACGGAGG - Intronic
1136446687 16:30326263-30326285 CACGTGAATCCGGGAGACGGAGG - Intergenic
1136464476 16:30432860-30432882 CACGTGAACCCAGGAGACGGAGG - Intergenic
1137241969 16:46663463-46663485 CACTTGAATCCAGGAGACGGAGG - Intronic
1145920995 17:28609967-28609989 CACTTCAACCCAGGAGACGGAGG + Intronic
1146012345 17:29206111-29206133 CACTTGAATCCAGGAGACGGAGG - Intergenic
1148684329 17:49492443-49492465 CACTTGAACCAAGGAGACGGAGG + Intergenic
1152847570 17:82611398-82611420 CACGTGAATCCAGGAGACAGAGG + Intronic
1154146418 18:11869873-11869895 CACGTCAGTCTGGGCGACAGAGG + Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1156205569 18:34882450-34882472 CACTTAAATCAGGGAGACGGAGG - Intronic
1158940309 18:62401491-62401513 CACTCCAATCTGGGCGACGGAGG - Intergenic
1162285019 19:9731820-9731842 CACTTCAACCCAGGAGACGGAGG - Intergenic
1165645051 19:37428756-37428778 CACTTGAATCCAGGAGACGGAGG - Intronic
1165864519 19:38928292-38928314 CACTTGAATCAAGGAGGCGGAGG + Intronic
926583005 2:14652177-14652199 CACTTGAATCCAGGAGACGGAGG + Intergenic
929993284 2:46807545-46807567 CACTTGAATCCAGGAGACGGAGG + Intergenic
936022217 2:109003492-109003514 CACGTGAACCCAGGAGACGGAGG - Intergenic
940068352 2:149654992-149655014 CACTTGAATCCAGGAGACGGAGG - Intergenic
941726237 2:168863992-168864014 CACTTGAATCCAGGAGACGGAGG - Intronic
941726245 2:168864049-168864071 CACTTGAATCCAGGAGACGGAGG - Intronic
948226064 2:236310170-236310192 CAGGTCAACCAAGGCAAAGGTGG - Intergenic
1168777639 20:461901-461923 CGCGTCAATCAAGCCGGCGACGG + Intronic
1171496287 20:25558289-25558311 CGCTTGAATCCAGGCGACGGAGG - Intronic
1181699557 22:24612608-24612630 CACCTGAATCCAGGAGACGGAGG - Intronic
1184166787 22:42734084-42734106 CACTTCAACCCAGGAGACGGAGG + Intergenic
953617682 3:44506794-44506816 CACTTGAATCCAGGAGACGGAGG - Intronic
958479651 3:94630502-94630524 CACTTGAACCAAGGAGACGGAGG + Intergenic
962588649 3:136866695-136866717 CACTTGAACCAAGGAGACGGAGG - Intronic
968079905 3:195838624-195838646 CACTTGAATCCAGGAGACGGAGG + Intergenic
974041984 4:56865365-56865387 CACTTGAATCTGGGCGACGGAGG - Intergenic
975451376 4:74530721-74530743 CACTTGAATCAAGGAGGCGGAGG + Intergenic
977466896 4:97393772-97393794 CACGTGAATCCAGGAGGCGGAGG - Intronic
980384498 4:132069712-132069734 CACTTGAATCCAGGAGACGGAGG - Intergenic
992909675 5:81383453-81383475 CACATTAATCAAGGCTACAGTGG + Intronic
998129017 5:139641880-139641902 CACCTCAATCCAGGGGAAGGAGG - Intergenic
1011656409 6:89555891-89555913 CACATAAATCAAGGCGGGGGAGG + Intronic
1021733190 7:23617262-23617284 CACTTGAATCCAGGAGACGGAGG + Intronic
1026283370 7:68941692-68941714 CACGTGAACCCAGGAGACGGAGG + Intergenic
1027363836 7:77436077-77436099 CACTTCAAACCAGGAGACGGAGG + Intergenic
1032714942 7:134500036-134500058 CACTTGAATCAAGGAGGCGGAGG + Intergenic
1056170494 9:83980323-83980345 CACGTCAATCAAGGCGACGGAGG + Intronic
1057403442 9:94744615-94744637 CACTTCAACCCAGGAGACGGAGG + Intronic
1060395728 9:123315110-123315132 CACTGCAATCCAGGAGACGGAGG - Intergenic
1062215563 9:135387639-135387661 CAAGACAAGCAAGGGGACGGAGG - Intergenic
1187884325 X:23875164-23875186 CACTTCAATCCAGGAGGCGGAGG + Intronic
1198320993 X:135519196-135519218 CACTTCAACCCAGGAGACGGAGG - Intergenic
1200248653 X:154540552-154540574 CACTTGAATCCAGGAGACGGAGG + Intronic
1201280302 Y:12336575-12336597 CACGTCAACCCAGGAGGCGGAGG + Intergenic