ID: 1056170495

View in Genome Browser
Species Human (GRCh38)
Location 9:83980326-83980348
Sequence GTCAATCAAGGCGACGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 41}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056170484_1056170495 26 Left 1056170484 9:83980277-83980299 CCAGGGCTTCAGCGATGGTGCGA 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1056170495 9:83980326-83980348 GTCAATCAAGGCGACGGAGGAGG 0: 1
1: 0
2: 0
3: 0
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056170495 Original CRISPR GTCAATCAAGGCGACGGAGG AGG Intronic
908497876 1:64713139-64713161 CTCAAACAAGGTGAAGGAGGTGG + Intergenic
915504031 1:156340908-156340930 TTGAATCAAGGAGACAGAGGTGG - Intronic
920109596 1:203577944-203577966 GTCAGTCAAGGGGAGAGAGGTGG + Intergenic
1085527080 11:77170491-77170513 GTGAATCAAGGAGGCGGTGGAGG + Intronic
1088821204 11:113459068-113459090 GTTAATCAAGGCCACACAGGTGG - Intronic
1096095496 12:48932822-48932844 GTCAATCCAGGCGAGGCAGCAGG - Intronic
1100874978 12:98952272-98952294 GTCATTCAAGGCCACAGAGCAGG + Intronic
1108894192 13:55302685-55302707 GTAAATTAAGGGGATGGAGGAGG - Intergenic
1118694058 14:68366825-68366847 GTCAAACAAGGTCACGGAAGAGG - Intronic
1124014028 15:25861717-25861739 GTCAAGCAAGGTGAGGCAGGAGG + Intronic
1125884471 15:43218423-43218445 GTCAGTGAAGGCTACAGAGGTGG - Intronic
1132665126 16:1078060-1078082 GTCACACAGGGCGAAGGAGGGGG - Intergenic
1135471722 16:22737143-22737165 GTCAGTCAAGGTGCTGGAGGAGG + Intergenic
1137984777 16:53098648-53098670 CTCAATCAACGCGAGGCAGGAGG + Intronic
1155280079 18:24230234-24230256 GACAAACAAGGAGAGGGAGGAGG + Intronic
1164559834 19:29283117-29283139 GTCACTCAAGGGGACAGAAGAGG + Intergenic
925939686 2:8804999-8805021 ATCAATCAAAGCCAAGGAGGGGG - Intronic
936663880 2:114572669-114572691 GTTAATGAAGGGGAAGGAGGAGG + Intronic
937459024 2:122069628-122069650 ATCATTCAAGGCGATGGAGATGG + Intergenic
942642963 2:178079287-178079309 GCCCATCAAGGGGACGGGGGAGG - Intronic
944243039 2:197504201-197504223 GTCACTCAAGGAGGCGGACGTGG - Intronic
1169088255 20:2840527-2840549 GGAAAGCAAGGCGATGGAGGTGG + Exonic
1172811133 20:37649182-37649204 GTCAATCAAGGCCAAAGAGAAGG - Intergenic
1173645278 20:44629461-44629483 GTCAACCAAGGATATGGAGGGGG - Intronic
959263646 3:104112068-104112090 GACAATCAAGGTGGCGGTGGTGG + Intergenic
965714444 3:171587516-171587538 GTCAGTCAGGGTGATGGAGGAGG - Intergenic
990938355 5:61174406-61174428 GTCACTCAAGGATAGGGAGGAGG - Intergenic
1003625888 6:7740960-7740982 GCCAATGAAGGTGATGGAGGAGG - Intronic
1012004636 6:93697306-93697328 GTCAGTTAAGGTGATGGAGGAGG + Intergenic
1017901724 6:158723822-158723844 GTCAATCAAAGCTACAGCGGAGG - Intronic
1024778382 7:52816201-52816223 ATCAATCAAGGGGAATGAGGAGG + Intergenic
1027001444 7:74657442-74657464 GTCAATGGAGGCGAGGGTGGTGG - Intergenic
1027168327 7:75852130-75852152 TTCAATCCAGGAGGCGGAGGTGG - Intronic
1036776667 8:11617591-11617613 TTCAGTCAGGGCCACGGAGGAGG - Intergenic
1048256166 8:132906704-132906726 GCCATTCAACGCGTCGGAGGTGG + Exonic
1056028204 9:82523630-82523652 ATCAAACAAGCCGATGGAGGTGG - Intergenic
1056170495 9:83980326-83980348 GTCAATCAAGGCGACGGAGGAGG + Intronic
1060074576 9:120579970-120579992 GTCCATCATGGCTACAGAGGTGG + Exonic
1061017567 9:127990881-127990903 GTCAATCAAAGCCATGAAGGGGG + Intergenic
1187663978 X:21583218-21583240 GTCAATCAGGGTGAAGGATGTGG - Intronic
1193800447 X:85929340-85929362 GTCAATGAAGGCCACTAAGGAGG - Intronic
1197805718 X:130396658-130396680 GTCAATAAAGGAGACTGAGAAGG - Intergenic