ID: 1056175620

View in Genome Browser
Species Human (GRCh38)
Location 9:84032080-84032102
Sequence ATTTTCCACTAAAAGAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056175620_1056175623 9 Left 1056175620 9:84032080-84032102 CCTTACTTCTTTTAGTGGAAAAT No data
Right 1056175623 9:84032112-84032134 AGCATATCATATGGGCACTGAGG No data
1056175620_1056175622 1 Left 1056175620 9:84032080-84032102 CCTTACTTCTTTTAGTGGAAAAT No data
Right 1056175622 9:84032104-84032126 ATATGCAGAGCATATCATATGGG No data
1056175620_1056175621 0 Left 1056175620 9:84032080-84032102 CCTTACTTCTTTTAGTGGAAAAT No data
Right 1056175621 9:84032103-84032125 GATATGCAGAGCATATCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056175620 Original CRISPR ATTTTCCACTAAAAGAAGTA AGG (reversed) Intergenic
No off target data available for this crispr