ID: 1056179178

View in Genome Browser
Species Human (GRCh38)
Location 9:84065028-84065050
Sequence AGGGGAATCCACCTTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056179173_1056179178 3 Left 1056179173 9:84065002-84065024 CCTTTAGGGGAGGAGGCAGACTT No data
Right 1056179178 9:84065028-84065050 AGGGGAATCCACCTTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056179178 Original CRISPR AGGGGAATCCACCTTGAGGC AGG Intergenic
No off target data available for this crispr