ID: 1056181336

View in Genome Browser
Species Human (GRCh38)
Location 9:84085874-84085896
Sequence CATTCTTTCTGCCCAAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056181336_1056181346 11 Left 1056181336 9:84085874-84085896 CCTCCACTTGGGCAGAAAGAATG No data
Right 1056181346 9:84085908-84085930 CCTCTTCTTATGACTGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056181336 Original CRISPR CATTCTTTCTGCCCAAGTGG AGG (reversed) Intergenic
No off target data available for this crispr