ID: 1056195503

View in Genome Browser
Species Human (GRCh38)
Location 9:84224774-84224796
Sequence TAGAACAAAGAAAGGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056195496_1056195503 2 Left 1056195496 9:84224749-84224771 CCTCCAGGCCCCTCAGGAAGAAA 0: 32
1: 72
2: 94
3: 98
4: 313
Right 1056195503 9:84224774-84224796 TAGAACAAAGAAAGGTGGTCAGG No data
1056195498_1056195503 -6 Left 1056195498 9:84224757-84224779 CCCCTCAGGAAGAAATATAGAAC No data
Right 1056195503 9:84224774-84224796 TAGAACAAAGAAAGGTGGTCAGG No data
1056195499_1056195503 -7 Left 1056195499 9:84224758-84224780 CCCTCAGGAAGAAATATAGAACA No data
Right 1056195503 9:84224774-84224796 TAGAACAAAGAAAGGTGGTCAGG No data
1056195497_1056195503 -1 Left 1056195497 9:84224752-84224774 CCAGGCCCCTCAGGAAGAAATAT No data
Right 1056195503 9:84224774-84224796 TAGAACAAAGAAAGGTGGTCAGG No data
1056195500_1056195503 -8 Left 1056195500 9:84224759-84224781 CCTCAGGAAGAAATATAGAACAA No data
Right 1056195503 9:84224774-84224796 TAGAACAAAGAAAGGTGGTCAGG No data
1056195493_1056195503 18 Left 1056195493 9:84224733-84224755 CCTATGGGTGTGACTTCCTCCAG No data
Right 1056195503 9:84224774-84224796 TAGAACAAAGAAAGGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056195503 Original CRISPR TAGAACAAAGAAAGGTGGTC AGG Intergenic
No off target data available for this crispr