ID: 1056200172

View in Genome Browser
Species Human (GRCh38)
Location 9:84267933-84267955
Sequence TATCATTAAGTCCCCTGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056200172_1056200177 11 Left 1056200172 9:84267933-84267955 CCAATACAGGGGACTTAATGATA No data
Right 1056200177 9:84267967-84267989 AGTCATCCCTTGGTATTCCTGGG No data
1056200172_1056200178 12 Left 1056200172 9:84267933-84267955 CCAATACAGGGGACTTAATGATA No data
Right 1056200178 9:84267968-84267990 GTCATCCCTTGGTATTCCTGGGG No data
1056200172_1056200176 10 Left 1056200172 9:84267933-84267955 CCAATACAGGGGACTTAATGATA No data
Right 1056200176 9:84267966-84267988 CAGTCATCCCTTGGTATTCCTGG No data
1056200172_1056200182 18 Left 1056200172 9:84267933-84267955 CCAATACAGGGGACTTAATGATA No data
Right 1056200182 9:84267974-84267996 CCTTGGTATTCCTGGGGGATTGG No data
1056200172_1056200175 1 Left 1056200172 9:84267933-84267955 CCAATACAGGGGACTTAATGATA No data
Right 1056200175 9:84267957-84267979 AAGGGATGACAGTCATCCCTTGG No data
1056200172_1056200183 25 Left 1056200172 9:84267933-84267955 CCAATACAGGGGACTTAATGATA No data
Right 1056200183 9:84267981-84268003 ATTCCTGGGGGATTGGTTCCAGG 0: 2
1: 29
2: 210
3: 604
4: 1269
1056200172_1056200179 13 Left 1056200172 9:84267933-84267955 CCAATACAGGGGACTTAATGATA No data
Right 1056200179 9:84267969-84267991 TCATCCCTTGGTATTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056200172 Original CRISPR TATCATTAAGTCCCCTGTAT TGG (reversed) Intergenic
No off target data available for this crispr