ID: 1056200758

View in Genome Browser
Species Human (GRCh38)
Location 9:84274080-84274102
Sequence CTGCATGACCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056200754_1056200758 4 Left 1056200754 9:84274053-84274075 CCATAGTGATCTGTGGGTTTGCC No data
Right 1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG No data
1056200750_1056200758 21 Left 1056200750 9:84274036-84274058 CCCAACTCTGCTCTTGGCCATAG No data
Right 1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG No data
1056200751_1056200758 20 Left 1056200751 9:84274037-84274059 CCAACTCTGCTCTTGGCCATAGT No data
Right 1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG No data
1056200749_1056200758 22 Left 1056200749 9:84274035-84274057 CCCCAACTCTGCTCTTGGCCATA No data
Right 1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056200758 Original CRISPR CTGCATGACCAGAAGGTGGA AGG Intergenic
No off target data available for this crispr