ID: 1056214847

View in Genome Browser
Species Human (GRCh38)
Location 9:84397457-84397479
Sequence CCTGCTAAGCAGCTCTTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056214847_1056214853 5 Left 1056214847 9:84397457-84397479 CCATCTAAGAGCTGCTTAGCAGG No data
Right 1056214853 9:84397485-84397507 GGGGTCAATATCACAGAGGCCGG No data
1056214847_1056214854 13 Left 1056214847 9:84397457-84397479 CCATCTAAGAGCTGCTTAGCAGG No data
Right 1056214854 9:84397493-84397515 TATCACAGAGGCCGGATCAGAGG No data
1056214847_1056214855 23 Left 1056214847 9:84397457-84397479 CCATCTAAGAGCTGCTTAGCAGG No data
Right 1056214855 9:84397503-84397525 GCCGGATCAGAGGCAGAAGCTGG No data
1056214847_1056214857 24 Left 1056214847 9:84397457-84397479 CCATCTAAGAGCTGCTTAGCAGG No data
Right 1056214857 9:84397504-84397526 CCGGATCAGAGGCAGAAGCTGGG No data
1056214847_1056214852 1 Left 1056214847 9:84397457-84397479 CCATCTAAGAGCTGCTTAGCAGG No data
Right 1056214852 9:84397481-84397503 GACAGGGGTCAATATCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056214847 Original CRISPR CCTGCTAAGCAGCTCTTAGA TGG (reversed) Intergenic
No off target data available for this crispr