ID: 1056215515

View in Genome Browser
Species Human (GRCh38)
Location 9:84402688-84402710
Sequence CAGAATAGGGACAAAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056215515_1056215520 -2 Left 1056215515 9:84402688-84402710 CCTGCCACTTTGTCCCTATTCTG No data
Right 1056215520 9:84402709-84402731 TGGACACCCTCTTCCAATGAAGG No data
1056215515_1056215524 17 Left 1056215515 9:84402688-84402710 CCTGCCACTTTGTCCCTATTCTG No data
Right 1056215524 9:84402728-84402750 AAGGTATCTGCCACCGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056215515 Original CRISPR CAGAATAGGGACAAAGTGGC AGG (reversed) Intergenic
No off target data available for this crispr