ID: 1056216455

View in Genome Browser
Species Human (GRCh38)
Location 9:84409651-84409673
Sequence AGACCACGAACCCACACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056216453_1056216455 -10 Left 1056216453 9:84409638-84409660 CCTGAAGCCAGCGAGACCACGAA 0: 233
1: 918
2: 1248
3: 1053
4: 598
Right 1056216455 9:84409651-84409673 AGACCACGAACCCACACTGAAGG No data
1056216452_1056216455 13 Left 1056216452 9:84409615-84409637 CCACGAAGGTCTGCAGCTTCACT 0: 888
1: 1324
2: 1188
3: 1427
4: 1535
Right 1056216455 9:84409651-84409673 AGACCACGAACCCACACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056216455 Original CRISPR AGACCACGAACCCACACTGA AGG Intergenic
No off target data available for this crispr