ID: 1056221245

View in Genome Browser
Species Human (GRCh38)
Location 9:84452506-84452528
Sequence GCTGCTTCAAGTCACCATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056221245_1056221248 16 Left 1056221245 9:84452506-84452528 CCTGAATGGTGACTTGAAGCAGC No data
Right 1056221248 9:84452545-84452567 CCTACTGTCCAGGTGTCCCAAGG No data
1056221245_1056221246 6 Left 1056221245 9:84452506-84452528 CCTGAATGGTGACTTGAAGCAGC No data
Right 1056221246 9:84452535-84452557 CTGCACACTACCTACTGTCCAGG No data
1056221245_1056221249 21 Left 1056221245 9:84452506-84452528 CCTGAATGGTGACTTGAAGCAGC No data
Right 1056221249 9:84452550-84452572 TGTCCAGGTGTCCCAAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056221245 Original CRISPR GCTGCTTCAAGTCACCATTC AGG (reversed) Intergenic
No off target data available for this crispr