ID: 1056230693

View in Genome Browser
Species Human (GRCh38)
Location 9:84539728-84539750
Sequence AGGGAGAACACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056230693_1056230700 14 Left 1056230693 9:84539728-84539750 CCCACAATCACTGTGTTCTCCCT No data
Right 1056230700 9:84539765-84539787 GATTCTCTCTCCATGCCATGTGG No data
1056230693_1056230702 25 Left 1056230693 9:84539728-84539750 CCCACAATCACTGTGTTCTCCCT No data
Right 1056230702 9:84539776-84539798 CATGCCATGTGGCCACTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056230693 Original CRISPR AGGGAGAACACAGTGATTGT GGG (reversed) Intergenic