ID: 1056234722

View in Genome Browser
Species Human (GRCh38)
Location 9:84583261-84583283
Sequence ATATTTTACCAGGAGTCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056234722_1056234725 11 Left 1056234722 9:84583261-84583283 CCCATAGACTCCTGGTAAAATAT No data
Right 1056234725 9:84583295-84583317 AATGTTTTCATACACATGAGTGG No data
1056234722_1056234726 16 Left 1056234722 9:84583261-84583283 CCCATAGACTCCTGGTAAAATAT No data
Right 1056234726 9:84583300-84583322 TTTCATACACATGAGTGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056234722 Original CRISPR ATATTTTACCAGGAGTCTAT GGG (reversed) Intergenic
No off target data available for this crispr