ID: 1056235669

View in Genome Browser
Species Human (GRCh38)
Location 9:84591518-84591540
Sequence CAGAGTTATCAGATTTGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056235668_1056235669 11 Left 1056235668 9:84591484-84591506 CCAAGATAACAAAATTAACAACA No data
Right 1056235669 9:84591518-84591540 CAGAGTTATCAGATTTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056235669 Original CRISPR CAGAGTTATCAGATTTGATG AGG Intergenic
No off target data available for this crispr