ID: 1056236413

View in Genome Browser
Species Human (GRCh38)
Location 9:84599020-84599042
Sequence CATTGTTGGCAGAAATTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056236407_1056236413 -5 Left 1056236407 9:84599002-84599024 CCAAATCTCCTTCTGCCTCATTG No data
Right 1056236413 9:84599020-84599042 CATTGTTGGCAGAAATTGGGTGG No data
1056236405_1056236413 10 Left 1056236405 9:84598987-84599009 CCCTTCTCTCTTTCTCCAAATCT No data
Right 1056236413 9:84599020-84599042 CATTGTTGGCAGAAATTGGGTGG No data
1056236406_1056236413 9 Left 1056236406 9:84598988-84599010 CCTTCTCTCTTTCTCCAAATCTC No data
Right 1056236413 9:84599020-84599042 CATTGTTGGCAGAAATTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056236413 Original CRISPR CATTGTTGGCAGAAATTGGG TGG Intergenic
No off target data available for this crispr