ID: 1056237490 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:84609652-84609674 |
Sequence | CTATGTATGCAGCTGGTGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1056237485_1056237490 | -4 | Left | 1056237485 | 9:84609633-84609655 | CCATCTGAACCTTAGAGGCCTAT | No data | ||
Right | 1056237490 | 9:84609652-84609674 | CTATGTATGCAGCTGGTGGATGG | No data | ||||
1056237483_1056237490 | 12 | Left | 1056237483 | 9:84609617-84609639 | CCATCTCATGGCTCAGCCATCTG | No data | ||
Right | 1056237490 | 9:84609652-84609674 | CTATGTATGCAGCTGGTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1056237490 | Original CRISPR | CTATGTATGCAGCTGGTGGA TGG | Intergenic | ||
No off target data available for this crispr |