ID: 1056237490

View in Genome Browser
Species Human (GRCh38)
Location 9:84609652-84609674
Sequence CTATGTATGCAGCTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056237485_1056237490 -4 Left 1056237485 9:84609633-84609655 CCATCTGAACCTTAGAGGCCTAT No data
Right 1056237490 9:84609652-84609674 CTATGTATGCAGCTGGTGGATGG No data
1056237483_1056237490 12 Left 1056237483 9:84609617-84609639 CCATCTCATGGCTCAGCCATCTG No data
Right 1056237490 9:84609652-84609674 CTATGTATGCAGCTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056237490 Original CRISPR CTATGTATGCAGCTGGTGGA TGG Intergenic
No off target data available for this crispr