ID: 1056237643

View in Genome Browser
Species Human (GRCh38)
Location 9:84611005-84611027
Sequence CATTCTTCCCATAAAGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056237643_1056237645 7 Left 1056237643 9:84611005-84611027 CCTACCTCTTTATGGGAAGAATG No data
Right 1056237645 9:84611035-84611057 ACTTGAAGCCATGTTTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056237643 Original CRISPR CATTCTTCCCATAAAGAGGT AGG (reversed) Intergenic
No off target data available for this crispr