ID: 1056241169

View in Genome Browser
Species Human (GRCh38)
Location 9:84647895-84647917
Sequence AGTTATCAGCAGATTATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056241166_1056241169 25 Left 1056241166 9:84647847-84647869 CCACTAAGGCCTGGTAGTAGGTT No data
Right 1056241169 9:84647895-84647917 AGTTATCAGCAGATTATGGTAGG No data
1056241167_1056241169 16 Left 1056241167 9:84647856-84647878 CCTGGTAGTAGGTTAAGAGCTGT No data
Right 1056241169 9:84647895-84647917 AGTTATCAGCAGATTATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056241169 Original CRISPR AGTTATCAGCAGATTATGGT AGG Intergenic
No off target data available for this crispr