ID: 1056242096

View in Genome Browser
Species Human (GRCh38)
Location 9:84657903-84657925
Sequence AAGCTGATATTAAAGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056242094_1056242096 10 Left 1056242094 9:84657870-84657892 CCTGAAAAGGCAGTTGAGATAAA No data
Right 1056242096 9:84657903-84657925 AAGCTGATATTAAAGAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056242096 Original CRISPR AAGCTGATATTAAAGAAACA AGG Intergenic
No off target data available for this crispr