ID: 1056248538

View in Genome Browser
Species Human (GRCh38)
Location 9:84723640-84723662
Sequence CTGTAGTGTGGCAGGTGATC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056248534_1056248538 13 Left 1056248534 9:84723604-84723626 CCTCACTGTGGAGGAAGGAAAGT 0: 1
1: 0
2: 5
3: 35
4: 346
Right 1056248538 9:84723640-84723662 CTGTAGTGTGGCAGGTGATCCGG 0: 1
1: 0
2: 0
3: 8
4: 131
1056248532_1056248538 18 Left 1056248532 9:84723599-84723621 CCTAACCTCACTGTGGAGGAAGG 0: 1
1: 0
2: 0
3: 29
4: 180
Right 1056248538 9:84723640-84723662 CTGTAGTGTGGCAGGTGATCCGG 0: 1
1: 0
2: 0
3: 8
4: 131
1056248530_1056248538 23 Left 1056248530 9:84723594-84723616 CCGCACCTAACCTCACTGTGGAG 0: 1
1: 0
2: 1
3: 9
4: 167
Right 1056248538 9:84723640-84723662 CTGTAGTGTGGCAGGTGATCCGG 0: 1
1: 0
2: 0
3: 8
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056248538 Original CRISPR CTGTAGTGTGGCAGGTGATC CGG Exonic
909609210 1:77535397-77535419 CTGTACTGTGTCAGGTGAGTGGG - Intronic
910884716 1:91952402-91952424 CTGCAGTCTGGCAGGTGCACTGG + Intronic
912222537 1:107694719-107694741 CTGTAGTGTAGCAGGGCTTCTGG - Intronic
921151890 1:212409301-212409323 CTGGAGGGTGGGAGGTAATCTGG + Intronic
923166810 1:231372302-231372324 ATGTAGTGTGTCAGTTGTTCTGG - Intronic
923817178 1:237393817-237393839 CTGTAGTTTGTCATGTGTTCTGG + Intronic
1066177605 10:32925574-32925596 CTGTACTGTAGCTGGTGGTCTGG - Intronic
1068408729 10:56626786-56626808 CTGTAGTGTGACAGATGTTGGGG + Intergenic
1070592429 10:77810631-77810653 CTGGAGTGTGGCAGGGGAGGTGG - Intronic
1070649143 10:78222447-78222469 CTATGGTGTGGCGGGTGACCTGG - Intergenic
1072265837 10:93727096-93727118 CTGGAGTGTGGCAGGGAACCAGG - Intergenic
1072447812 10:95514950-95514972 CTGTAGTGTGGGAGGGGAGTGGG - Intronic
1072752164 10:97989040-97989062 CTGCAGTGAGGCAGGGGATGAGG - Intronic
1073255121 10:102146096-102146118 CTGGAGTGTAGTAGCTGATCAGG + Intronic
1075470380 10:122684435-122684457 AGGTAGTGTGACAGGTGACCAGG - Intergenic
1076271045 10:129152457-129152479 CTGTGGTGGGGCAGGTGCTAGGG + Intergenic
1078668899 11:13347943-13347965 CTGGAGTGAGGCACGAGATCAGG + Intronic
1079870810 11:25795260-25795282 CAGTAGTGTGGGTGGTGACCTGG - Intergenic
1084818247 11:71664007-71664029 CTGTGGTGGGGGAGGTGATGTGG + Intergenic
1084914044 11:72414384-72414406 CTGTAGTGTGACAGGTTTCCTGG - Intronic
1086406774 11:86505350-86505372 CTGTAGTTTGGCATGTGAACAGG - Intronic
1090469710 11:126969362-126969384 CTGCAGTGTGGCAGGTGTGAAGG + Intronic
1091696759 12:2633081-2633103 CCGCAGGGTGGCAGGTTATCTGG - Intronic
1092067712 12:5605669-5605691 CTGTGGTGTGGCATGTGTTTCGG + Intronic
1096776755 12:53969087-53969109 CTGTGGTGAGGCGGGAGATCTGG + Intergenic
1103325150 12:120115553-120115575 TTGGAGTGTGGCAGGTGAGCAGG - Intronic
1107408987 13:40141171-40141193 GTGGAGTGTGGCAGGTGCACAGG + Intergenic
1108278795 13:48840137-48840159 CTGAAGTGGGCCAGGTGACCAGG + Intergenic
1113720611 13:112553216-112553238 CTGTAGTGTGGCTGGTGGGCAGG - Intronic
1113810516 13:113139511-113139533 CTGAAGAGTGGCAGGTGGGCGGG + Intronic
1114249765 14:20948670-20948692 CTGTAGTCTAATAGGTGATCGGG + Intergenic
1115498421 14:34028492-34028514 GAGTTGTGAGGCAGGTGATCTGG - Intronic
1118989347 14:70783796-70783818 GTGTAGTCTGGGAGGTGAGCGGG - Intronic
1129619721 15:77133058-77133080 ATGTTGTGAGGCAGGTGATGCGG - Exonic
1129798785 15:78397720-78397742 CTGAACTGTGGCAAGTGGTCAGG + Intergenic
1130366822 15:83248272-83248294 GTGTGGTGTGGCTGGTGACCCGG + Intergenic
1134660380 16:15979928-15979950 CTGGGGTGTGGCAAGTAATCAGG - Intronic
1136276663 16:29182860-29182882 CTGGCATGTGGCAGGTGCTCTGG + Intergenic
1138437271 16:57010092-57010114 CTGAAGTGGGGAAGGTGGTCTGG + Intronic
1139224917 16:65225270-65225292 CTGAAGGGTGGCAGGCTATCAGG - Intergenic
1141623587 16:85249809-85249831 CTGCAGTTTGGCAGGTGGGCAGG + Intergenic
1142155165 16:88529676-88529698 CTGGAGGGCGGCAGGTGGTCTGG + Intronic
1142807467 17:2379057-2379079 TTGCTGTGTGGGAGGTGATCTGG + Exonic
1145086594 17:19947169-19947191 CTGCAGTGTAGCGGGTGCTCAGG - Intronic
1145816217 17:27796933-27796955 CTGTGGTGTGGTAGGTGAATTGG - Intronic
1148151490 17:45398932-45398954 CTGGAGTGTGGGAGGTGGTGGGG - Intronic
1149649976 17:58270772-58270794 CTGTGTTGTCGCAGATGATCCGG + Exonic
1152790130 17:82274191-82274213 CTGGAGGGAGGCAGGTGGTCTGG - Intergenic
1161505185 19:4639902-4639924 CTGTAGGGCCGCAGGTGCTCAGG + Intronic
1165285435 19:34838172-34838194 CTTTAGTGAGGCTGGAGATCTGG + Intergenic
1168076634 19:53983832-53983854 GGGTAGTGAGGCAGGTGAGCGGG + Exonic
930595403 2:53381479-53381501 CTGCTGTGTGACAGGTCATCTGG - Intergenic
932369771 2:71177450-71177472 CTGGTCTGTGGCAGGTGGTCTGG - Intergenic
936510020 2:113137726-113137748 CTGTAGTGTTGTAGTAGATCAGG - Intergenic
945424277 2:209680786-209680808 CTGTTCTGAGGCAGGTGATGGGG - Exonic
947865926 2:233397722-233397744 CTGTAGGGTGGAGGGTGAACTGG + Intronic
947898553 2:233699094-233699116 CTGTTTTGGGGCAGGTGATGAGG - Intronic
948898933 2:240946310-240946332 CTGCAGTGTGGCAGGGTATGGGG + Intronic
949046987 2:241876834-241876856 CTCTAGTGGGGCAGGGGCTCTGG + Intergenic
1171987260 20:31669178-31669200 CTGTAGTGTGGCAGCTACTCAGG - Intronic
1172343344 20:34177021-34177043 CTGTTGTGTGGTAGGTGAATGGG - Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173648317 20:44647477-44647499 CTGTAGACTGGCAAGTGAACAGG - Intronic
1173669881 20:44791505-44791527 CTGGAATGTGGCATGTGCTCAGG + Intronic
1173831414 20:46091531-46091553 TTGTAGGGAGGCAGGTGCTCAGG + Intergenic
1176131144 20:63497368-63497390 CTGTGGTGAGGGAGGTGACCTGG - Intronic
1178484732 21:33011692-33011714 TTGTAGTTTGTCAGGTGATATGG + Intergenic
1178580791 21:33836435-33836457 CTGCAGTGTGCCAGGTGATTGGG + Exonic
1178732410 21:35116967-35116989 CTGTAGTATGGCAGGGATTCAGG + Intronic
1180783891 22:18536350-18536372 CTGTGGGGTGGCAGGTGCTCAGG + Intergenic
1181127459 22:20710399-20710421 CTGTGGGGTGGCAGGTGCTCAGG + Intronic
1181240791 22:21475702-21475724 CTGTGGGGTGGCAGGTGCTCAGG + Intergenic
1182991946 22:34776593-34776615 CTACTGTGTGGAAGGTGATCTGG + Intergenic
1183155480 22:36071697-36071719 CTCCAGTGTGGCAGGGTATCAGG - Intergenic
1183478765 22:38051386-38051408 CTGCAGAGTGGCTGGTGATGGGG - Intergenic
1183809005 22:40238246-40238268 CTCTAGTGTGGTGGGTGCTCTGG + Intronic
1183977068 22:41518387-41518409 CTGGTGTTTGGCAGGTGCTCAGG + Intronic
1185168110 22:49274755-49274777 CTGTAGCCTGGCAGGTGCTTGGG - Intergenic
950052972 3:10006024-10006046 CTGTAGGCTGGCAGGTGTACTGG - Intronic
950092212 3:10304071-10304093 ATGTGGTGTGGCATGTGAGCTGG - Exonic
950765071 3:15267511-15267533 CTGCAGATTGGCAGGTGTTCCGG - Intronic
952157007 3:30654414-30654436 CTGTAGGGAGGCAGGGGAACTGG - Intronic
952751416 3:36827836-36827858 CAGCAGTGTGGCAGGAGATGAGG + Exonic
962417286 3:135194595-135194617 CTGTAGTGTGGAAGGGTAGCTGG + Intronic
963952683 3:151220450-151220472 CTGGAGTTTGGCACGTGATATGG + Intronic
970434273 4:16018314-16018336 CTGAACTGAGGCAGGTGAGCAGG - Exonic
970600157 4:17635771-17635793 CAGAAGTGAGGCAGGTGAGCAGG + Intronic
973547755 4:51999057-51999079 CTCTAGTGTAGCAGGGGCTCAGG - Intronic
977246165 4:94634043-94634065 GGGTAGAGTGGCAGGAGATCAGG + Intronic
980654646 4:135766217-135766239 CTGTAATGTAGCAGGTGGGCAGG + Intergenic
982069920 4:151686107-151686129 CAGGAGGGTGGCAGGTGCTCTGG + Intronic
986735481 5:10664665-10664687 CGGCAGTGTGCCAGGTGATTGGG - Intergenic
998455526 5:142269704-142269726 CTGAAGTGGGGGAGGGGATCTGG + Intergenic
1006814926 6:36843649-36843671 CTGTAGTGTGGCTGGAGCACAGG + Intergenic
1009585416 6:65595313-65595335 CTGTTGTGTGGTAGGTGGACAGG + Intronic
1012191733 6:96287909-96287931 CTGGAGTGTGGCAGCTCAGCTGG + Intergenic
1014733426 6:125062360-125062382 TTGTATTTTGGCAGGTAATCAGG + Intronic
1019620744 7:1990736-1990758 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620756 7:1990792-1990814 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620768 7:1990848-1990870 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620780 7:1990904-1990926 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620792 7:1990960-1990982 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620804 7:1991016-1991038 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620816 7:1991072-1991094 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620828 7:1991128-1991150 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620840 7:1991184-1991206 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620852 7:1991240-1991262 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620916 7:1991520-1991542 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620928 7:1991576-1991598 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620940 7:1991632-1991654 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620952 7:1991688-1991710 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620964 7:1991744-1991766 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620976 7:1991800-1991822 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019620988 7:1991856-1991878 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019621000 7:1991912-1991934 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019621012 7:1991968-1991990 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019621024 7:1992024-1992046 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019621036 7:1992080-1992102 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019621048 7:1992136-1992158 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1019621060 7:1992192-1992214 CTCTGGTGGGGCAGGTGCTCAGG - Intronic
1021429141 7:20539557-20539579 CTGTAGTGTGGTATGTGTTTGGG - Intergenic
1023833002 7:44051020-44051042 ATGTGGTGTGGCAGGTGACTGGG + Intronic
1029386964 7:100249455-100249477 CTATAGTGTGGCTGGTGGTTAGG + Intronic
1029711470 7:102302342-102302364 CTGGAGTCTGGCAGCTGAGCTGG - Intronic
1030358108 7:108565763-108565785 TTTCAGGGTGGCAGGTGATCAGG - Intronic
1033763883 7:144466147-144466169 CAGGAGGGTGGCAGGAGATCTGG - Intronic
1035544988 8:473453-473475 CTGTATTGGGGCAGGTGCCCTGG - Intergenic
1035794727 8:2344327-2344349 ATGGAGTGTCGCAGGTGTTCTGG + Intergenic
1048482576 8:134813375-134813397 ATCTAATGTGGTAGGTGATCTGG - Intergenic
1049056371 8:140240453-140240475 CAGGAGTGTGCCAGGTGAGCTGG - Intronic
1049711965 8:144068854-144068876 CTGTGCTGTGGCAGGTGTTGGGG - Intergenic
1052972077 9:34382684-34382706 CTGTAGTTTGGGAGGTGGTGGGG + Intronic
1056248538 9:84723640-84723662 CTGTAGTGTGGCAGGTGATCCGG + Exonic
1058157279 9:101529659-101529681 GTATAGTGGGCCAGGTGATCTGG + Intronic
1060217147 9:121745245-121745267 CTGTGGTGTGGTGGGTGAGCAGG + Intronic
1061929719 9:133826270-133826292 CTTTAGTGTGGCGGGTCACCAGG - Intronic
1062398056 9:136360480-136360502 GTGTAGAGTGGCAGGAGATTAGG + Intronic
1190259307 X:48787953-48787975 CTCTAGTGGGGCAGCTGATAAGG + Intronic
1196475482 X:116079671-116079693 CTGTATTTTGGCTGGTGATGTGG + Intergenic
1199455133 X:148020084-148020106 CTGTTGTACTGCAGGTGATCTGG + Intronic