ID: 1056249280

View in Genome Browser
Species Human (GRCh38)
Location 9:84731717-84731739
Sequence ACTGGGCTGCCGCTGTCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056249280_1056249288 7 Left 1056249280 9:84731717-84731739 CCTCAAGACAGCGGCAGCCCAGT 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1056249288 9:84731747-84731769 GGTGCCAGTCACAGCGTGTGAGG No data
1056249280_1056249291 19 Left 1056249280 9:84731717-84731739 CCTCAAGACAGCGGCAGCCCAGT 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1056249291 9:84731759-84731781 AGCGTGTGAGGATGTGAGGCAGG No data
1056249280_1056249290 15 Left 1056249280 9:84731717-84731739 CCTCAAGACAGCGGCAGCCCAGT 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1056249290 9:84731755-84731777 TCACAGCGTGTGAGGATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056249280 Original CRISPR ACTGGGCTGCCGCTGTCTTG AGG (reversed) Intronic
902276446 1:15343362-15343384 TCTGGGGGGCTGCTGTCTTGAGG - Intronic
907044280 1:51290318-51290340 TCTGGGCTCCCGCAGCCTTGGGG - Intronic
907171481 1:52469993-52470015 ACTGGGCTGTCACTGCTTTGAGG - Intronic
907455341 1:54571976-54571998 ACTGGGCTGCTGGTTTCCTGGGG + Intronic
918635301 1:186766731-186766753 ACTGCACTGCCGCTGTATTCTGG + Intergenic
921576527 1:216841590-216841612 CCTGGCCTGCCACTGTCCTGAGG - Intronic
922563501 1:226586323-226586345 ACTGGGCTGCCGAACGCTTGGGG + Intronic
922917671 1:229271438-229271460 CCTGGGCTGCGGGGGTCTTGAGG + Intronic
924926347 1:248686960-248686982 ACTGGGCCGCCACAGTCTGGAGG + Intergenic
1063201317 10:3786769-3786791 TCTGGGCAGCCGTTGTGTTGGGG + Intergenic
1067645608 10:48098990-48099012 ACTGGGCTGCTGCTGTCCAATGG + Intergenic
1069888728 10:71639675-71639697 AGTGGACTGACGCTGTCTTTGGG + Intronic
1074087824 10:110222008-110222030 TCTGAGCTGCCGCTGACTTGAGG + Intronic
1074744900 10:116522870-116522892 ACTGGGCTCCCACTCTCCTGGGG + Intergenic
1076756940 10:132577496-132577518 AGTGGGCCCCTGCTGTCTTGAGG + Intronic
1076780894 10:132723803-132723825 CCCGGGCTGCCGCTCTCCTGGGG + Intronic
1084948287 11:72650754-72650776 TCAGGGCTGCAGCTGTCTGGTGG - Intronic
1088849093 11:113690734-113690756 ACAGGGCTGGCACTGTCATGTGG + Intronic
1089573570 11:119425392-119425414 ACAGGGCAGCCGCAGTCTTCTGG - Intergenic
1089771486 11:120806392-120806414 ATTGGGCAGCAGCTGGCTTGAGG - Intronic
1091217464 11:133911800-133911822 ATTGGGCTGCCGTTGTCAGGAGG - Intronic
1092218866 12:6700016-6700038 ACTGGGTTGGCGCTGGCTGGGGG - Intronic
1096106740 12:49000421-49000443 TTTGGGCTGCCTCTGTCCTGGGG + Intergenic
1099973895 12:89526079-89526101 ACAGGGCTGGCGGTGTCTCGGGG - Exonic
1100534562 12:95495757-95495779 ACTGAACTGGTGCTGTCTTGGGG + Intronic
1106161269 13:27203333-27203355 CCTGGGCTGCTGCTGGTTTGAGG - Intergenic
1113474668 13:110571935-110571957 GCTGGGCTGCCTCTGTTTTAAGG - Intergenic
1118895007 14:69938580-69938602 GTTGGGCTGCTGCTGTATTGGGG + Intronic
1122322949 14:100866507-100866529 ACTGGGGTGATGCTGTCGTGGGG + Intergenic
1122357778 14:101134312-101134334 TCTGGGCACCCGCTGCCTTGGGG - Intergenic
1122782843 14:104150871-104150893 GCTGGGCTGGTGCTGTCCTGGGG + Intronic
1125957431 15:43800063-43800085 ATTGGACTGCCACTGTGTTGGGG + Exonic
1130446327 15:84005161-84005183 TGTGGGCTGCTGGTGTCTTGGGG - Intronic
1130978425 15:88795002-88795024 ACTGGGAAGCAGCTGGCTTGGGG - Intergenic
1132571732 16:647215-647237 GCTGAGCTGCCGATGGCTTGGGG + Intronic
1132679480 16:1133883-1133905 CTCGGGCTCCCGCTGTCTTGAGG + Intergenic
1134716901 16:16361841-16361863 ACAGGGCTGTCTCCGTCTTGCGG + Intergenic
1134957850 16:18390318-18390340 ACAGGGCTGTCTCCGTCTTGCGG - Intergenic
1139613964 16:68077949-68077971 ACTGGGGAGCTGCTGACTTGAGG - Intronic
1142232461 16:88906219-88906241 ACGAGGCTGCCCCTGTCTAGCGG - Intronic
1142621823 17:1170127-1170149 ACTGGGCTGCCTCTTCCTAGGGG - Intronic
1143267574 17:5651650-5651672 ACTGGGCTGCCTCTGTCTTTGGG + Intergenic
1147216368 17:38901510-38901532 ACTGTGCTACAGCTGTCTGGAGG - Intronic
1147616967 17:41835586-41835608 ACTGGGGAGCCGCTGGCTTGGGG + Intronic
1148114889 17:45169773-45169795 AGAGGGCTGCCGCTGTGATGAGG + Exonic
1148558019 17:48590139-48590161 CCTGGGCCGCCGCTGCCTTCTGG + Intronic
1148778680 17:50109866-50109888 GCTGGGCTGCCGCTGAGCTGGGG + Intronic
1150462718 17:65366002-65366024 CCTTGGCTGCAGCTGTCTTCAGG - Intergenic
1150603509 17:66671288-66671310 TCTTGGCTGCCTCTGTCGTGTGG - Intronic
1157711206 18:49850903-49850925 ACTGGGCTGGCCAAGTCTTGTGG - Intronic
1162484794 19:10952995-10953017 CCTGTTCTGCCACTGTCTTGTGG + Intergenic
1166193813 19:41193565-41193587 AAGGGGCTGCTGCTGTCCTGGGG + Intronic
1167607524 19:50489437-50489459 TCTGGGCTGACGCTGTCTTAGGG - Exonic
925201754 2:1972795-1972817 ACTGGGGTCCCTCTGGCTTGCGG - Intronic
925317900 2:2939355-2939377 ATGTGGCTGCCTCTGTCTTGGGG - Intergenic
926099227 2:10103419-10103441 GCTGGGCTTCAGCTGTCCTGAGG - Intergenic
927591212 2:24360035-24360057 GCTGGGCTGCCCCTTCCTTGCGG - Intronic
928178196 2:29049382-29049404 ACTGGGCTGCTTCTGCCTTTTGG + Intronic
929791273 2:45024769-45024791 ACAGGGCTGCAGCTGTTTTGAGG + Intergenic
931441281 2:62292598-62292620 ACGGGGCTGCTGCTGTGGTGGGG - Intergenic
932810677 2:74823157-74823179 ACTGAGCTCCCACTGTCTGGAGG + Intergenic
936626725 2:114156608-114156630 ACTGGGCCTCCGCTGTTCTGAGG + Intergenic
938481125 2:131662536-131662558 ACTTTCCTGCCTCTGTCTTGGGG - Intergenic
941911874 2:170771377-170771399 ACTGGGGTGCGCCTGGCTTGCGG + Intergenic
942134964 2:172916121-172916143 CCTGGTCTGTTGCTGTCTTGTGG - Intronic
943162207 2:184269039-184269061 ACTGGGCAGCTGCTGTCTCAGGG + Intergenic
947143511 2:227042103-227042125 ATTGGGCTGCATCTTTCTTGTGG + Intronic
1169155454 20:3326004-3326026 ACTGTGCTGCTGTTGTCTTATGG - Intronic
1169196109 20:3682588-3682610 AACCGGCTGCCGCTGTCTTGGGG + Intergenic
1169203308 20:3726217-3726239 GCTTGGCTGCAGCTGTCTTTTGG - Intergenic
1169332037 20:4723604-4723626 TCTGAGCTGGCACTGTCTTGGGG - Intronic
1170706556 20:18749253-18749275 ACTGGGCTGCAGCTGCCTCCTGG - Intronic
1171157460 20:22889561-22889583 ACTGGGCTGTCTCTGACTTTTGG - Intergenic
1172517063 20:35542257-35542279 ACTGGCCTGCCGGTGTCTGAGGG + Intronic
1174097150 20:48098387-48098409 ACCGGGCTCCCTCTGTCTTGTGG - Intergenic
1176365965 21:6033058-6033080 ACTGGGCTGTGTCTGGCTTGGGG - Intergenic
1177323046 21:19546588-19546610 AGTGGGGTGCCACAGTCTTGTGG + Intergenic
1179757551 21:43505487-43505509 ACTGGGCTGTGTCTGGCTTGGGG + Intergenic
1180960966 22:19762178-19762200 GCTGGGCTGCCGCTGTCCTCAGG - Intronic
1182556003 22:31128621-31128643 ACTGGGCAGCCACAGGCTTGTGG - Exonic
1184034392 22:41911534-41911556 TCTGGGAAGCAGCTGTCTTGGGG - Intronic
950099108 3:10346329-10346351 ACTGGGCTGGTGCCGACTTGGGG + Intronic
952509435 3:34038590-34038612 TCTGGTCTCCTGCTGTCTTGGGG - Intergenic
952859567 3:37801800-37801822 ACTGTTCTGCTCCTGTCTTGCGG + Intronic
953180277 3:40588546-40588568 ACTGGCCTGGGGCTGCCTTGCGG + Intergenic
954660830 3:52225998-52226020 AGTCGGCAGCCGCTGTCCTGAGG - Exonic
956646105 3:71458202-71458224 TCTGGGCTGCATCTTTCTTGAGG - Intronic
956873394 3:73440085-73440107 ATTGAGGTGCCGCTGTCTTGAGG + Intronic
959741893 3:109730104-109730126 AGTGGGCTGCAGCTGGCCTGGGG - Intergenic
961485552 3:127213407-127213429 GCTGGGCTGCCTCTTTCCTGGGG - Intergenic
963753623 3:149210111-149210133 ACTGCCCTGCCCCTGTCTTTTGG + Intronic
963982560 3:151556051-151556073 ACTGGGCTGCAGCAGTCTGACGG + Intergenic
964013392 3:151917639-151917661 ACAAGGCTGCCTCTGACTTGAGG - Intergenic
965065198 3:163839387-163839409 ACTGGTCTGCTGGTGTCTTCTGG + Intergenic
969717366 4:8874203-8874225 TCTGGGCGCCCGCTGTCTGGGGG + Intergenic
978593322 4:110350261-110350283 ACTGGGCTGCAGTGGTCTTTGGG - Intergenic
982199962 4:152950574-152950596 GCTGGGCTGCCCCTGTGTTGGGG + Intronic
982332914 4:154201773-154201795 ACTGGGCTTCTGCTTTCTTTTGG + Intergenic
985329421 4:188812938-188812960 ACTGGTCTGTCTCTGTCATGAGG - Intergenic
985625338 5:982606-982628 CCTGGGCTGGGGCTGTGTTGTGG + Intergenic
985658024 5:1142192-1142214 GCTGGGCTGCCCCTGCCCTGTGG - Intergenic
997873262 5:137523755-137523777 CCTGGGCTGCAGCAGTCCTGTGG - Intronic
1000385904 5:160674637-160674659 ACTGGGCTATCTCTGTCTTGGGG - Intronic
1000658920 5:163915534-163915556 ACTGGCCTGCCGGTGTCTGCTGG + Intergenic
1003171787 6:3726204-3726226 ACTGGCCAGGCACTGTCTTGGGG - Intronic
1007079447 6:39088471-39088493 TCTCGGCTGCCTCTGTCCTGGGG + Intergenic
1017010912 6:150063528-150063550 CCTGGGCTGCCTCTGTGGTGTGG - Intronic
1019751038 7:2729943-2729965 TCTCGGATGCCGCTGTCCTGGGG - Exonic
1019888074 7:3922720-3922742 ACTGGGCTGCAACTGTGGTGGGG + Intronic
1022428087 7:30286054-30286076 ACTGGGCAGCCGCTGAGGTGAGG - Intronic
1025211755 7:57023253-57023275 ACTGGGCTGCAGCAGGCTTTGGG - Intergenic
1025660200 7:63553573-63553595 ACTGGGCTGCAGCAGGCTTTGGG + Intergenic
1026573621 7:71553955-71553977 TCTGGGCTGCGCCTGTCTTCTGG + Intronic
1028974430 7:96895949-96895971 AGTGGGCTGACCCTGTCTTTGGG + Intergenic
1029515298 7:101019846-101019868 TCTGGGCTGCCCCTCTGTTGGGG + Intergenic
1029743351 7:102503479-102503501 ACTGGCCTGCAGCTGCCTGGTGG - Intronic
1029761340 7:102602640-102602662 ACTGGCCTGCAGCTGCCTGGTGG - Intronic
1033195235 7:139321799-139321821 CCTGGCCTGCTGCTGTCCTGGGG - Intergenic
1034256623 7:149728292-149728314 CCTGGCCTGCGGCTGTCATGAGG - Intronic
1044313866 8:90726968-90726990 GCTGTGCTGCCTCTGTCCTGTGG + Intronic
1044893743 8:96865355-96865377 AGTGGGCTGTCTCTGTCTTAGGG + Intronic
1048876027 8:138837621-138837643 ACCGGGCTGCCCCTGTATTGGGG + Intronic
1049188083 8:141269914-141269936 ACTGGGCTGCCTCTGCTGTGGGG - Intronic
1049205586 8:141362011-141362033 GCGGGGCTGCCGCTGGGTTGGGG + Intronic
1056249280 9:84731717-84731739 ACTGGGCTGCCGCTGTCTTGAGG - Intronic
1056768310 9:89459020-89459042 GCTGGGCTGCAGCTCCCTTGGGG - Intronic
1056787223 9:89602071-89602093 CCTGGGATGCCCCTGTGTTGAGG - Intergenic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1061909098 9:133713373-133713395 GGTGGGGTCCCGCTGTCTTGTGG + Intronic
1062096630 9:134707083-134707105 CCTGGGGTGCCTCTGCCTTGAGG + Intronic
1062445475 9:136592274-136592296 CCTAGGCTGCAGCTGTCTGGGGG - Intergenic
1062510234 9:136901341-136901363 ACTGGGCTGCCTCTACCTTTGGG - Intronic
1186122993 X:6383396-6383418 ACTGGGCTGCTACAGTTTTGAGG - Intergenic
1190117826 X:47637594-47637616 ACTGGGCTGATGCTGGCTGGAGG - Intronic
1192150960 X:68712145-68712167 ACTGGCCTGTCGGGGTCTTGGGG - Intronic
1198597860 X:138256511-138256533 ACTGGGGTGCCACTTTCTTTGGG - Intergenic
1200754228 Y:6974913-6974935 GCTGGGCTGCTGGTCTCTTGTGG - Intronic