ID: 1056251562

View in Genome Browser
Species Human (GRCh38)
Location 9:84753626-84753648
Sequence TCTCAACTGCACCCAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056251554_1056251562 11 Left 1056251554 9:84753592-84753614 CCCACAGCTTTGCACACATTTTG 0: 1
1: 1
2: 2
3: 27
4: 239
Right 1056251562 9:84753626-84753648 TCTCAACTGCACCCAGGCCCAGG No data
1056251555_1056251562 10 Left 1056251555 9:84753593-84753615 CCACAGCTTTGCACACATTTTGG 0: 1
1: 0
2: 1
3: 16
4: 245
Right 1056251562 9:84753626-84753648 TCTCAACTGCACCCAGGCCCAGG No data
1056251553_1056251562 20 Left 1056251553 9:84753583-84753605 CCAAACTCACCCACAGCTTTGCA 0: 1
1: 0
2: 0
3: 25
4: 231
Right 1056251562 9:84753626-84753648 TCTCAACTGCACCCAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056251562 Original CRISPR TCTCAACTGCACCCAGGCCC AGG Intronic
No off target data available for this crispr