ID: 1056253210

View in Genome Browser
Species Human (GRCh38)
Location 9:84771971-84771993
Sequence ATAGAGTAGCAGAAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056253207_1056253210 -10 Left 1056253207 9:84771958-84771980 CCTTTGAGGCAAGATAGAGTAGC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056253210 Original CRISPR ATAGAGTAGCAGAAGGAGCA GGG Intronic
No off target data available for this crispr