ID: 1056254411

View in Genome Browser
Species Human (GRCh38)
Location 9:84783932-84783954
Sequence CAGCATGAGGAGATGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056254405_1056254411 13 Left 1056254405 9:84783896-84783918 CCCTAATTAAGTGTATGCTATAG 0: 1
1: 0
2: 1
3: 3
4: 121
Right 1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG No data
1056254406_1056254411 12 Left 1056254406 9:84783897-84783919 CCTAATTAAGTGTATGCTATAGA 0: 1
1: 0
2: 1
3: 9
4: 131
Right 1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056254411 Original CRISPR CAGCATGAGGAGATGGAGGT TGG Intronic
No off target data available for this crispr