ID: 1056255947

View in Genome Browser
Species Human (GRCh38)
Location 9:84799889-84799911
Sequence AATTAATTAGGGACTTGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056255947 Original CRISPR AATTAATTAGGGACTTGCGT TGG (reversed) Intronic
905543584 1:38779877-38779899 ACTTAATTAGGGACATGGTTAGG - Intergenic
909844084 1:80368459-80368481 AAAGAATTAGGCACTTGCTTTGG - Intergenic
914326409 1:146621238-146621260 AAATATTTAGGGAATTGAGTGGG - Intergenic
1063595354 10:7430116-7430138 AATTAATTATGGACTTCAGTTGG - Intergenic
1065475255 10:26129970-26129992 GATGAATTAGTGACTTGCATTGG + Intronic
1065526743 10:26630074-26630096 GATGAATTAGTGACTTGCATTGG + Intergenic
1066129295 10:32375446-32375468 AATAAATTAGGAAATTGTGTTGG + Intronic
1073976561 10:109108466-109108488 AAGTTATTAGGTACTTGCTTCGG - Intergenic
1078243300 11:9550420-9550442 AGGGAATTAGGGCCTTGCGTTGG - Intergenic
1080824093 11:35833345-35833367 AATTAACTTGTGACTTGCTTTGG + Intergenic
1082257451 11:50047337-50047359 AATCAACTAGGGAATTGCTTAGG - Intergenic
1084990794 11:72923620-72923642 AATGAGTTAAGGACTTGAGTAGG - Intronic
1087371586 11:97291696-97291718 AATTAATTATGGAGTTATGTTGG + Intergenic
1089892006 11:121890795-121890817 AATTAATAAGTGAATTGAGTAGG - Intergenic
1090521536 11:127485064-127485086 AATTAATTAGGGACAGGTATGGG + Intergenic
1096118235 12:49068955-49068977 AATAAATTATGGAGTTGGGTGGG + Intronic
1100967865 12:100032641-100032663 AATTAATTAGGCAATTGGGAAGG + Intronic
1102892956 12:116575330-116575352 AATGAATCAGGGAGTTGCATTGG + Intergenic
1136341736 16:29648483-29648505 CATTTATTAGGGACTTCGGTGGG + Intergenic
1138111545 16:54328164-54328186 AATTAAATAGGAACTTGTTTGGG + Intergenic
1139931883 16:70534300-70534322 AATTATTAAGGGACTGGGGTAGG + Intronic
1140007156 16:71089707-71089729 AAATATTTAGGGAATTGAGTGGG + Intronic
1145856274 17:28161491-28161513 AATTCATTAGGCAGTTGAGTGGG + Intronic
1147522459 17:41187765-41187787 AATTAATTAGGGCATTGGTTCGG - Intergenic
1150375535 17:64678471-64678493 AATTAATTAGAGAGCTGGGTGGG - Intergenic
1152522856 17:80870060-80870082 AGTTAATTAAGGACTCCCGTAGG + Intronic
1156572224 18:38269321-38269343 AGTTAGTTAGGGCCTTGCTTTGG + Intergenic
1158808587 18:61004789-61004811 GATTAATTTGTGACTTGCTTTGG - Intergenic
1161774118 19:6248744-6248766 ACTAAACTAGGGACTTGCCTTGG - Intronic
1166908572 19:46133801-46133823 TATTATTTAGGGGCTTGCCTGGG - Intergenic
931745955 2:65292266-65292288 ACTCAATTAGGGACTGGCTTTGG + Intergenic
938585573 2:132687081-132687103 AATGAATTAGGGATTTGCCTTGG + Intronic
943823441 2:192357385-192357407 AATTCCTTACGGACTTGCATTGG + Intergenic
944093962 2:195945964-195945986 AATTTATTAGGGACTCTCTTGGG - Intronic
944508785 2:200444011-200444033 AAAGAATTAGGGATTTGCGAGGG + Intronic
945139390 2:206667638-206667660 AATTAATTAAGGAGTAGAGTAGG - Intronic
945677057 2:212868276-212868298 AATTAAAGAGGCACTTGGGTTGG - Intergenic
947173215 2:227333878-227333900 AATCAATCAGGGAATTGCTTGGG - Intronic
947692142 2:232148467-232148489 AATTTATTACGGACTTTCATTGG - Intronic
1174896541 20:54455295-54455317 AATGAATTAAAGACTTGTGTAGG + Intergenic
1175400619 20:58698076-58698098 GGTTTATGAGGGACTTGCGTGGG + Intronic
1181869788 22:25888676-25888698 AATTAATGAGGGACTCTCCTAGG - Intronic
953538431 3:43793560-43793582 AATCAGTTAGGGACTGGAGTTGG - Intergenic
956949118 3:74259445-74259467 AATTATTTAGGGACATGGCTAGG + Intergenic
957779644 3:84802109-84802131 GATTAATTTGGGAATTGAGTTGG - Intergenic
958445575 3:94210735-94210757 ACTGAATTTGGGACTTGTGTGGG + Intergenic
960422054 3:117458870-117458892 AATTAATTAGTGATTCGGGTAGG + Intergenic
966243044 3:177775675-177775697 CATTAATTAGGGCCTTGGGAAGG - Intergenic
971356159 4:25897001-25897023 AATTAATCAGTGATTTGCCTAGG - Intronic
976859492 4:89646105-89646127 AATTAATTGTGGACTTTCTTTGG - Intergenic
978044913 4:104114211-104114233 ACTGAATTATGGACTTGCCTGGG - Intergenic
978045157 4:104116270-104116292 AATTAATGTGGCACTTGGGTAGG - Intergenic
978165345 4:105600670-105600692 AATTAAGTAGAGATTTGAGTGGG - Intronic
978525529 4:109661400-109661422 AATTAATTTGGAACTTGGATAGG - Intronic
981008112 4:139896555-139896577 ACTAAATGAGGGACTTGCGCTGG - Intronic
981214031 4:142142137-142142159 AATTAATTAGTGAATTGATTAGG - Intronic
981494635 4:145377545-145377567 AATTAATTAGGAATTTGGATGGG + Intergenic
987512844 5:18863067-18863089 ACTCAATTAGGTACTTCCGTGGG + Intergenic
987637244 5:20559870-20559892 AATTAATTAGGGAGATGTGCAGG + Intronic
990993104 5:61704232-61704254 AATTAATCAGGGACTCCCATGGG + Exonic
991502426 5:67290240-67290262 AATGAATCAGGGATTTGGGTGGG - Intergenic
994056579 5:95423344-95423366 AATAGACTAGGGGCTTGCGTGGG + Intronic
998177680 5:139911860-139911882 AATAAATTAGGTACTTACATAGG - Intronic
1004852218 6:19711915-19711937 AATAAATTAGGGACCTGATTAGG - Intergenic
1005963584 6:30710961-30710983 AAATATTTAGGGACTGGCCTGGG - Intronic
1007305515 6:40901009-40901031 AGGTATTTTGGGACTTGCGTAGG + Intergenic
1007477808 6:42130568-42130590 AAATGATTAGGGCCTTGCCTAGG - Intronic
1009952808 6:70415742-70415764 AATTAAATAGGGATTTGTGGTGG + Intronic
1013148253 6:107416692-107416714 AATTAATCTGGCACTTGCTTTGG + Intronic
1019042004 6:169114092-169114114 AATTAATTAGGTAAATGCTTAGG + Intergenic
1027511687 7:79090191-79090213 AATTAATTATGTAATTGCATAGG + Intronic
1032565505 7:132938535-132938557 AATTAAATAAGAACTTGCCTAGG - Intronic
1036497699 8:9284375-9284397 ATTTAATTGGGAACTTGTGTAGG + Intergenic
1039520800 8:38169668-38169690 AATTAATTTGGTAGTTGCCTAGG + Intronic
1044917012 8:97125278-97125300 AATTAATTAGGGAACTACCTGGG - Intronic
1044946512 8:97394724-97394746 AATAAATGAGGGACATGCGGAGG + Intergenic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1048479232 8:134772465-134772487 AAATAATTAGGGCCTTGCTCTGG - Intergenic
1051114232 9:13675655-13675677 AGTTAAGTAGGGGCTTGAGTAGG - Intergenic
1051380865 9:16457314-16457336 ACTTACTTAGGGACCTGTGTTGG + Intronic
1056255947 9:84799889-84799911 AATTAATTAGGGACTTGCGTTGG - Intronic
1056507641 9:87272153-87272175 AATTGATTAGGAACTTGGATGGG - Intergenic
1059882826 9:118710621-118710643 AATTAATCAGAGACTTGCCTTGG - Intergenic
1186008687 X:5104765-5104787 AATTAACTAGTGTCTTGCTTTGG - Intergenic
1187231028 X:17423452-17423474 AATTAATTAGAGACTTGGAAGGG + Intronic
1199325559 X:146494101-146494123 ACTGAATTTTGGACTTGCGTGGG + Intergenic