ID: 1056260298

View in Genome Browser
Species Human (GRCh38)
Location 9:84841836-84841858
Sequence TTATTACAATGAACTGTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 1, 2: 0, 3: 36, 4: 398}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056260298_1056260300 29 Left 1056260298 9:84841836-84841858 CCTAAAACAGTTCATTGTAATAA 0: 1
1: 1
2: 0
3: 36
4: 398
Right 1056260300 9:84841888-84841910 GAACATCCCAGGTTGAATCTAGG No data
1056260298_1056260299 18 Left 1056260298 9:84841836-84841858 CCTAAAACAGTTCATTGTAATAA 0: 1
1: 1
2: 0
3: 36
4: 398
Right 1056260299 9:84841877-84841899 AATGAAAGAATGAACATCCCAGG No data
1056260298_1056260301 30 Left 1056260298 9:84841836-84841858 CCTAAAACAGTTCATTGTAATAA 0: 1
1: 1
2: 0
3: 36
4: 398
Right 1056260301 9:84841889-84841911 AACATCCCAGGTTGAATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056260298 Original CRISPR TTATTACAATGAACTGTTTT AGG (reversed) Intronic
902707539 1:18216049-18216071 ATATTACAATGGAATGTGTTTGG + Intronic
907682920 1:56580614-56580636 TTCTTACACTGACTTGTTTTGGG + Intronic
908157373 1:61367726-61367748 CAATTACAAGGAGCTGTTTTAGG - Intronic
908620947 1:65978695-65978717 TAATTATAATGTAGTGTTTTTGG + Intronic
909348495 1:74620849-74620871 CTATTACAATGATCTATTTGGGG - Exonic
909949322 1:81701193-81701215 TGATTAAAATAAAATGTTTTTGG + Intronic
910891997 1:92028284-92028306 TTTTTAAAATGTCCTGTTTTAGG - Intergenic
910930994 1:92442381-92442403 ATATTACAAAGAACTTTTTAAGG - Intergenic
910944059 1:92569553-92569575 TTTTTAAAATGAAATATTTTGGG + Intronic
911436626 1:97867984-97868006 TTATTAGTTTGAACTATTTTTGG - Intronic
911469770 1:98303100-98303122 TTATTTCAATATATTGTTTTAGG + Intergenic
911697755 1:100911965-100911987 TTATTTCTATCAACTGTTTTGGG + Intronic
911731831 1:101299606-101299628 TAATTAAAAAGAATTGTTTTTGG + Intergenic
912015797 1:105034150-105034172 TTATTAGAAATAAATGTTTTAGG - Intergenic
912404888 1:109428681-109428703 TTGTTACAATGCACTCTCTTGGG - Intergenic
913576141 1:120176980-120177002 TTCTTACCATAAACTGTTTAAGG - Intergenic
914017813 1:143837342-143837364 ATATAACAAGGATCTGTTTTAGG + Intergenic
914656423 1:149745872-149745894 ATATAACAAGGATCTGTTTTAGG + Intergenic
914898142 1:151695370-151695392 TTACTACCATGAAGTGTTTCAGG - Exonic
915143776 1:153782630-153782652 TTATTTCAATTAACTTTTTGTGG - Intergenic
915274433 1:154778274-154778296 TTATTATATTGAACTGAGTTGGG - Intronic
915778303 1:158516036-158516058 TTATTTTAATGAACTTTTTGGGG + Intergenic
916828733 1:168469161-168469183 CTATTACAATGAAATGGTTGAGG + Intergenic
921499614 1:215885431-215885453 TAGTTTCATTGAACTGTTTTAGG + Intronic
921629373 1:217415071-217415093 TTATTACAATTATTTGTTTATGG + Intergenic
923675704 1:236079153-236079175 TTTTGACAATGAAGTATTTTTGG - Intergenic
924390827 1:243554624-243554646 TTAGTACAATGCACTGTTGGTGG + Intronic
1066589426 10:36977691-36977713 TCCTAAGAATGAACTGTTTTAGG - Intergenic
1067076467 10:43188707-43188729 TTACTAGAATTAACAGTTTTTGG - Intergenic
1068732046 10:60369293-60369315 TCATAACAATAAACTGTTTATGG - Intronic
1069205203 10:65673894-65673916 TTATTTCAGTGAAATGTTTAAGG - Intergenic
1069474901 10:68723499-68723521 TCATTACAATATACTGTATTTGG + Intronic
1069973493 10:72193665-72193687 TAATTAAAATGGACTTTTTTGGG - Intronic
1070100775 10:73384333-73384355 TTAGTAAAAGGAACTGTTCTTGG + Intronic
1070493258 10:76997166-76997188 ATATTACACTAAACTGATTTTGG + Intronic
1071224115 10:83508155-83508177 TTACTACAAAGCACAGTTTTTGG + Intergenic
1071224160 10:83508658-83508680 TGAATACAATAAACTGGTTTTGG - Intergenic
1071321863 10:84468480-84468502 TTAAAACAATGAAATGGTTTTGG + Intronic
1072372354 10:94776915-94776937 TTATTAGCATGAACAGTTTTGGG - Intronic
1072977490 10:100071717-100071739 TTGTTATAATGTACTGTTTAAGG - Intronic
1073088492 10:100912360-100912382 TTATTCCAATGGAGTTTTTTGGG + Intergenic
1073742421 10:106423316-106423338 GTATTTTAATGTACTGTTTTAGG + Intergenic
1073847494 10:107574684-107574706 TTATTAAATTGTACTGTGTTAGG - Intergenic
1074614201 10:115050275-115050297 TTTTTATAATTAACTGGTTTTGG - Intergenic
1074654321 10:115566534-115566556 TAATTAAAATGCACTATTTTAGG + Intronic
1074795778 10:116942172-116942194 TAATTAAAATGAATTGTTTTGGG + Intronic
1075030117 10:119018229-119018251 TTATAAGAATCAACTTTTTTAGG + Intergenic
1076212681 10:128661037-128661059 GTTTCACAATGAACTATTTTAGG + Intergenic
1076458193 10:130618830-130618852 GCATTAGAATGATCTGTTTTTGG + Intergenic
1078073914 11:8140000-8140022 TTATTCCAATCTACGGTTTTGGG - Exonic
1078621243 11:12910436-12910458 TTATTATTATGAATAGTTTTGGG - Intronic
1078960444 11:16261072-16261094 ATATTACAATGGACTGTTGAAGG - Intronic
1079724748 11:23867202-23867224 TTATCACCATGACCTGTTTTTGG - Intergenic
1079878448 11:25891195-25891217 GTTTTGCAATAAACTGTTTTAGG - Intergenic
1081119291 11:39245402-39245424 ATATTACAATGAAATTGTTTAGG - Intergenic
1081156199 11:39694645-39694667 GTATTACATTGAAGTGTGTTGGG - Intergenic
1081464408 11:43303055-43303077 ATACTACAATAAACTGTTGTTGG + Intergenic
1081505326 11:43710691-43710713 TTATTAAAATGAAGTTTATTTGG + Intronic
1082734564 11:56841814-56841836 TTATTTCAAAGATTTGTTTTGGG - Intergenic
1082929313 11:58582798-58582820 TTTTCACAATGAACTATTTAGGG + Intronic
1083269371 11:61563791-61563813 CTATGACAATTAACTATTTTGGG + Intronic
1084058907 11:66656632-66656654 TTGTGACAATGTACTTTTTTGGG + Intronic
1084772815 11:71355013-71355035 TTGTTTCAATGCACTGTTTTGGG + Intergenic
1086162345 11:83736095-83736117 TTATTAAAATAAAATGATTTAGG - Intronic
1086564153 11:88205756-88205778 TTGTTACATTGAACTATGTTTGG - Intergenic
1087282806 11:96231236-96231258 CTAGTACAATAAAGTGTTTTCGG - Intronic
1087466841 11:98518543-98518565 TTAATTCCATAAACTGTTTTGGG + Intergenic
1087786082 11:102355973-102355995 TTATTAGTTTTAACTGTTTTTGG + Intronic
1087790095 11:102396386-102396408 TTATTATAATGACCAGCTTTTGG - Exonic
1089839825 11:121406375-121406397 TTACTACCATAACCTGTTTTGGG - Intergenic
1091065480 11:132507092-132507114 TTTTTACAATTTAATGTTTTAGG - Intronic
1091351213 11:134896482-134896504 TTATTATTATAAAATGTTTTTGG + Intergenic
1093564086 12:20581057-20581079 TTCTTACAATGAACTAATTTGGG + Intronic
1093876799 12:24357946-24357968 TTATTACAATCCCTTGTTTTGGG + Intergenic
1094052344 12:26234852-26234874 TTATTTCAAAAATCTGTTTTTGG + Intronic
1094257135 12:28445123-28445145 TTATTGGCATGTACTGTTTTAGG + Intronic
1094468505 12:30779904-30779926 TTCTTACAATTAATTGGTTTTGG + Intergenic
1094801501 12:34041549-34041571 TTATTACATTAAAATGTTTCTGG - Intergenic
1095114632 12:38337545-38337567 TTATTACATTAAAATGTTTCCGG - Intergenic
1095855685 12:46858310-46858332 TTATTCCATTGCACTGGTTTTGG - Intergenic
1096682178 12:53263386-53263408 TTACTACTATTAAATGTTTTGGG + Intergenic
1098273741 12:68793390-68793412 GTGTTACAGTGACCTGTTTTGGG + Intronic
1098374118 12:69794821-69794843 TTATTAGATTTTACTGTTTTAGG + Intronic
1098441141 12:70519917-70519939 TAATTATAAAGAACTATTTTAGG + Exonic
1098539101 12:71632010-71632032 TTTTTAAAATCAGCTGTTTTAGG + Exonic
1098598299 12:72298520-72298542 TTACTTTAAAGAACTGTTTTTGG + Intronic
1099754507 12:86826581-86826603 AAAATTCAATGAACTGTTTTGGG - Intronic
1100015777 12:90009268-90009290 GTTTTACAATAAACTGCTTTTGG + Intergenic
1101102897 12:101411811-101411833 TTATTAAAATGAAGTCTTTGAGG + Intergenic
1105878691 13:24583984-24584006 ACATCACAAAGAACTGTTTTTGG + Intergenic
1106025615 13:25952872-25952894 TTTTTACTATGAACCTTTTTAGG - Intronic
1106978276 13:35247817-35247839 TTAATAAAATAAACTATTTTGGG - Intronic
1107095305 13:36529137-36529159 TTATTGAAATGAACTGATTATGG - Intergenic
1107374868 13:39792742-39792764 TTATTACAATGTCATGTATTAGG - Intergenic
1107742083 13:43461460-43461482 TTCTTACAAGAAACTGTATTAGG + Intronic
1108022895 13:46146659-46146681 TTATCAGAATTAAATGTTTTAGG - Intronic
1108999221 13:56776005-56776027 TTATTACAATTATATGTTCTCGG + Intergenic
1109017392 13:57035412-57035434 TTATTACTAGGCACTGTATTTGG - Intergenic
1109403422 13:61865446-61865468 TTATTACATTTAACTTATTTGGG + Intergenic
1109520400 13:63502957-63502979 TTATTATAATGAAATCTTTTTGG + Intergenic
1109640719 13:65187960-65187982 TTAAAACAATGTACTCTTTTGGG - Intergenic
1110291265 13:73809289-73809311 ATATTACAATGAAATGTTTGGGG + Intronic
1110300279 13:73918504-73918526 TTTTTACACAGAACTATTTTAGG + Intronic
1110420688 13:75304565-75304587 AAAGTACAATGAACTGATTTTGG + Intronic
1110618949 13:77573133-77573155 TTATTACATTGAATTGTTGCTGG - Intronic
1111576964 13:90167310-90167332 TAATTACCATGATTTGTTTTTGG - Intergenic
1111678741 13:91418173-91418195 TTAGTACTATGAATGGTTTTAGG + Intronic
1111795381 13:92912522-92912544 TTATGACAATCAAGTGTTTACGG - Intergenic
1112133015 13:96544309-96544331 GTAATATAATGAACTGTTTCTGG + Intronic
1112593235 13:100783764-100783786 ATGTTACAATGAAATGTTTTTGG - Intergenic
1112687534 13:101848424-101848446 TTATTACATTACACTTTTTTAGG - Intronic
1113094230 13:106646703-106646725 TAATTTTAATGAATTGTTTTAGG + Intergenic
1113235996 13:108275367-108275389 TTTTAACAATGAACCTTTTTAGG - Intronic
1116757700 14:48968499-48968521 TTGTCACAAAGAACAGTTTTAGG + Intergenic
1117601812 14:57383964-57383986 TTATTAAAATGAACACTTTGAGG - Intergenic
1119579002 14:75757368-75757390 TACTTTCACTGAACTGTTTTAGG - Intronic
1119970243 14:78962121-78962143 CTAGTACAATGAACTGTCTTTGG - Intronic
1120196300 14:81487179-81487201 CTATTACAATCAACTGTATAAGG - Intronic
1121792276 14:96708065-96708087 TTGTTACAATGGACTGCTTTAGG - Intergenic
1123925324 15:25103443-25103465 TTGTTATACTGTACTGTTTTAGG - Intergenic
1125855619 15:42946663-42946685 TCCTTACAATAAACTCTTTTTGG - Intronic
1126515486 15:49530685-49530707 TTTTTACAATAAATAGTTTTTGG - Intronic
1127631966 15:60836015-60836037 TCATTACACTGACCTCTTTTAGG + Intronic
1127745138 15:61961490-61961512 TTATTTGAATAAACTGTGTTGGG + Intronic
1128427319 15:67555119-67555141 TTATTAAAAGGACCTCTTTTAGG + Intronic
1129346942 15:74927491-74927513 TTAGTACAATGAACACATTTTGG + Intronic
1129489487 15:75909606-75909628 TTATGAAAATGAACTTTTTGAGG + Intronic
1130162953 15:81420104-81420126 TATTTATAATGAACTGCTTTAGG + Intergenic
1131120953 15:89823265-89823287 CTTTTACAATGAACTTCTTTGGG + Intergenic
1132172968 15:99681903-99681925 TTTGTACAAAGAACTGTTTGAGG - Intronic
1135693757 16:24568037-24568059 TTATTTCAATGAACAGATATTGG - Intronic
1135819290 16:25666511-25666533 TAATTCAAAAGAACTGTTTTAGG + Intergenic
1135835168 16:25818931-25818953 TTATTTCAAAGAACTGTGCTGGG + Intronic
1137069178 16:35884516-35884538 TAATTTCAATAAAGTGTTTTAGG + Intergenic
1137815836 16:51396666-51396688 TTATGACAATTAAGTTTTTTGGG + Intergenic
1138428483 16:56952161-56952183 CTATTATAATCAAGTGTTTTTGG - Intergenic
1138849970 16:60615979-60616001 TTATTACAATCAACAATTTGAGG - Intergenic
1139542950 16:67632100-67632122 TTATTGCACTGAACTGTTGGGGG + Intronic
1141988635 16:87596417-87596439 TTATTAAAAACAACTGCTTTTGG - Intergenic
1142167048 16:88597482-88597504 TTTTTAAAATGTACTTTTTTGGG - Intronic
1144199874 17:12930905-12930927 TTATGACAATGCACTTTGTTAGG + Intronic
1144234447 17:13244024-13244046 TTATTTCAATGGACTGCCTTAGG + Intergenic
1144310557 17:14010349-14010371 TTGTTTGAATGAAGTGTTTTGGG - Intergenic
1145023174 17:19447783-19447805 TGATTTCAATGCACTGTTCTTGG + Intergenic
1145967172 17:28927808-28927830 GTATTCCAATCAACAGTTTTGGG + Intronic
1146212873 17:30955889-30955911 TTATTATTATGAATTGTTTTTGG - Intronic
1147301219 17:39529370-39529392 TTATAACTAAAAACTGTTTTTGG + Intronic
1148823415 17:50374549-50374571 TTTTTAAAAAGAACAGTTTTTGG + Intronic
1149465326 17:56874009-56874031 CAAGTACAGTGAACTGTTTTTGG - Intergenic
1149839296 17:59944691-59944713 TGATTATAAGAAACTGTTTTAGG + Intronic
1150260291 17:63784207-63784229 TTACTATAATAAACAGTTTTTGG + Intronic
1152385799 17:79973881-79973903 TTATTACAGTATATTGTTTTGGG - Intronic
1153923725 18:9813992-9814014 TAAGAACAATGAACAGTTTTAGG - Intronic
1154219301 18:12438019-12438041 CTATTCTAATGAGCTGTTTTAGG + Intergenic
1155669500 18:28351609-28351631 TTATCACCATAACCTGTTTTTGG + Intergenic
1155843131 18:30670577-30670599 TTATTACAATCAACTCTCATTGG + Intergenic
1155962482 18:32006273-32006295 TGATTACTATGAACTGTCTCAGG - Intergenic
1158233588 18:55287017-55287039 TTCTTACCATGAATTGTTTTGGG - Intronic
1159389339 18:67768824-67768846 TTATTAGAATAAATTGTTATTGG - Intergenic
1159497155 18:69221536-69221558 TTCTTCCACTGAAGTGTTTTGGG - Intergenic
1159718439 18:71854373-71854395 TTATTACTGTGAAATTTTTTAGG + Intergenic
1160214143 18:76912100-76912122 TGATTACAGTGAACTATTTGGGG + Intronic
1160614377 18:80113157-80113179 TTAATAAAATGCACTGATTTGGG - Intronic
1161797924 19:6398152-6398174 TTTTTAAAATGTATTGTTTTGGG - Intergenic
1163959086 19:20670439-20670461 TTATTTCCATAAACTGTTCTTGG + Intronic
1164718992 19:30417733-30417755 TTATCACAAGGACATGTTTTGGG + Intronic
1166644011 19:44517737-44517759 TTAATTCAAAGAAGTGTTTTAGG + Intronic
1167632488 19:50634112-50634134 TTCTTACAATCAAAGGTTTTAGG + Intronic
925110100 2:1327718-1327740 TTAATAAAAACAACTGTTTTTGG - Intronic
925527229 2:4816120-4816142 TTGTTACACTGTACTGTTTAAGG + Intergenic
925685389 2:6466900-6466922 TTATTACTTCAAACTGTTTTGGG + Intergenic
926507107 2:13730701-13730723 TTAGTAAAATGAAATCTTTTAGG - Intergenic
927009625 2:18889543-18889565 TTATTACAAATAACAGTTTGTGG - Intergenic
927337700 2:21944276-21944298 TTAATACAAAGAAATGTTATAGG - Intergenic
928054169 2:28034421-28034443 TTATTACTATTAGCTTTTTTTGG + Intronic
929242666 2:39667507-39667529 ATATTAAAATGTACTGATTTTGG - Intronic
929322690 2:40564292-40564314 TTAGCACAATTAACTGTCTTAGG + Intronic
929930023 2:46247045-46247067 TGATTACATTGAGCTTTTTTTGG + Intergenic
930470329 2:51804498-51804520 TTATTAAAATGAACAATTTTTGG + Intergenic
930785239 2:55265365-55265387 TAACGACAATGAACTGTTTGTGG - Intronic
931015325 2:57971973-57971995 TAATTACATTGAATTGTCTTTGG + Intronic
931572969 2:63689167-63689189 TTATTACTAGGGTCTGTTTTGGG + Intronic
931740499 2:65238280-65238302 TTATCACAATGATATGTTCTCGG + Intronic
932277026 2:70459230-70459252 TTATTTAAATGAAATGTATTGGG - Intronic
932990951 2:76786790-76786812 TTCTTTAAATGAACTATTTTTGG - Intronic
933056249 2:77670607-77670629 TGACTACAATGAACTGATATAGG + Intergenic
933927803 2:87114922-87114944 TGACTACAATGAACTGATATAGG + Intergenic
934078198 2:88445836-88445858 TTAATACAATAAACCGTTTGTGG - Intergenic
935478192 2:103551575-103551597 TAATTTTAATGAATTGTTTTTGG - Intergenic
936962902 2:118095150-118095172 TTTTTAAAATAAACTGCTTTTGG + Intronic
937630514 2:124096601-124096623 ATATTCCAATGAACTATTTGGGG + Intronic
939292431 2:140213658-140213680 TTGTTACACTGTACTGTTTAGGG - Intergenic
939539383 2:143474853-143474875 TGATTACAATTAACTCATTTAGG + Intronic
939558086 2:143701355-143701377 TTATTATTAAGAACTGTATTTGG + Intronic
939883007 2:147651162-147651184 TTAGTTAAATGAACTGCTTTAGG + Intergenic
939973831 2:148693544-148693566 TTATTGAAATGAACTGTTTGAGG + Intronic
941341634 2:164312579-164312601 ATAATACAAAGAAATGTTTTGGG - Intergenic
941619147 2:167757220-167757242 TTATTACACTGAACTGAATGGGG - Intergenic
941756598 2:169193093-169193115 GTATAACAATGAACTGTCTCTGG - Intronic
942166096 2:173242570-173242592 TGAATACAATGGTCTGTTTTTGG + Intronic
942274075 2:174305721-174305743 TTATTCCCATGAATTTTTTTTGG + Intergenic
942282139 2:174376382-174376404 TTAGTAAAATGAACTTTTTCAGG - Intronic
942879529 2:180842315-180842337 TTAAAACAATAAACTGATTTAGG + Intergenic
943914752 2:193616085-193616107 TTATATCAATGAACGGTTTGGGG - Intergenic
944148423 2:196531355-196531377 TTATTATTATTAAATGTTTTTGG + Intronic
944150092 2:196548581-196548603 TTATTACAATGACCTGTTTTGGG - Intronic
944989161 2:205215080-205215102 TTATTACCATGCACTTTTCTAGG + Intronic
945112000 2:206368811-206368833 TTATCACCAGGAACTGTATTAGG + Intergenic
945706343 2:213238059-213238081 TTATTAGAAAGAATTGTTTCTGG + Intergenic
946994683 2:225378085-225378107 TTATTACAATGTAGTTATTTAGG + Intergenic
947517662 2:230821598-230821620 TTATTCGGATGAAGTGTTTTTGG - Intergenic
948322267 2:237080247-237080269 TTATTACACTGATTGGTTTTTGG + Intergenic
1170403284 20:16010553-16010575 TTATTACATCAAACTGCTTTGGG + Intronic
1171225860 20:23441640-23441662 TTATTATACTGTACTGTTTAGGG + Intronic
1172145660 20:32756194-32756216 ATATTTCAATGACCCGTTTTGGG + Intergenic
1174523552 20:51153904-51153926 TTCTCACAATGAACTTCTTTGGG - Intergenic
1174904447 20:54535733-54535755 TTGGTACAATGAACTTTTTAAGG + Intronic
1174960071 20:55146274-55146296 TTGTTATAATGTACTGTTTAGGG - Intergenic
1176891100 21:14320477-14320499 TTATTATAATTCACTCTTTTTGG + Intergenic
1176947499 21:15000897-15000919 TGATTAAAATGAACTATTTGAGG - Intronic
1176956445 21:15109760-15109782 TTATTACATTGAAGAGTTTTTGG - Intergenic
1177070247 21:16496125-16496147 TTACTACAAAGAACAGATTTGGG + Intergenic
1177110038 21:17015617-17015639 TTTTTACCATGAATTGATTTTGG - Intergenic
1177335439 21:19719348-19719370 ATATTAAAATTAACTGTTTTGGG + Intergenic
1177628507 21:23697552-23697574 ATAATACATTGAACTGTTTCAGG - Intergenic
1177915707 21:27085832-27085854 TTAGAACAATGCACTGTTTAAGG + Intergenic
1178430438 21:32513991-32514013 TTGTTACCATGTATTGTTTTGGG - Intronic
1178843834 21:36157889-36157911 TATTTACAGTGAACTTTTTTGGG + Intronic
1182159885 22:28111007-28111029 GCATTAAAATGTACTGTTTTGGG - Intronic
1183790720 22:40066549-40066571 TTATTACACTGAGCTCATTTTGG - Intronic
949263021 3:2124322-2124344 TTATTAAAATGGGCGGTTTTAGG + Intronic
950466174 3:13155814-13155836 GCATTACAGTGAACAGTTTTTGG - Intergenic
952262032 3:31749458-31749480 TTATTTCTAGGCACTGTTTTAGG - Intronic
952384894 3:32833231-32833253 TAATTACAATCAACAGGTTTGGG - Intronic
952593351 3:34985143-34985165 TGATTACAGTGACTTGTTTTTGG + Intergenic
954018543 3:47717919-47717941 TTATTACTTTGAACAGTTTGAGG + Intronic
955634072 3:61006618-61006640 TTTTTACAATTAACTGCATTTGG + Intronic
956090188 3:65658183-65658205 TGATTATAATTAACTGATTTTGG + Intronic
956184731 3:66551495-66551517 TTTTTAAAAGAAACTGTTTTAGG - Intergenic
956574419 3:70736026-70736048 ATATTAAAATGAAGTATTTTGGG - Intergenic
956656290 3:71555717-71555739 TTATTTCCATGCACTTTTTTCGG - Intronic
957629405 3:82699456-82699478 TTATTAAACAGAAATGTTTTAGG - Intergenic
958517983 3:95145383-95145405 TTATTTAAATGTACTTTTTTTGG - Intergenic
959462710 3:106646046-106646068 TTATTAGCATGATCTGTTTTGGG - Intergenic
959897680 3:111623140-111623162 TGATTTCAATGGACTGTTGTTGG + Intronic
961667964 3:128505350-128505372 TAATAATAATGAACTGTTTTAGG + Intergenic
963700817 3:148624177-148624199 TTAATACAGTAAAGTGTTTTGGG - Intergenic
963924964 3:150942047-150942069 TTATTAAAATGTACAGATTTGGG - Intronic
964032111 3:152150693-152150715 TTATTTCAAGGAAGAGTTTTTGG + Intergenic
964098486 3:152961864-152961886 ATGTTACAATGAATTGCTTTAGG - Intergenic
965204751 3:165707295-165707317 TTGTTACACTGTACTGTTTAAGG + Intergenic
965460009 3:168950999-168951021 TAATTACAATTTACTATTTTGGG - Intergenic
965532580 3:169788956-169788978 TTGTTACAATGCAGTGTTTTGGG + Exonic
965653170 3:170954308-170954330 TGATTTCAAAGAACTGTTTTTGG + Intergenic
966072237 3:175893314-175893336 TCATAAAAAGGAACTGTTTTTGG + Intergenic
966535487 3:181028533-181028555 TTATTAATATTAACTATTTTAGG - Intergenic
967699097 3:192570782-192570804 CTGTTACAGTGAACTTTTTTTGG - Intronic
969839417 4:9869750-9869772 TAACTTGAATGAACTGTTTTTGG + Intronic
970208081 4:13676242-13676264 TTTTAACAATGAACATTTTTAGG - Intergenic
970208113 4:13677095-13677117 TTTTAACAATGAACATTTTTAGG + Intergenic
970768809 4:19585017-19585039 TTATGACAACCCACTGTTTTGGG - Intergenic
970778145 4:19702381-19702403 TTATTCCAATGAACAGTAGTTGG - Intergenic
971669652 4:29541251-29541273 TTATTAAATTGATCTATTTTGGG - Intergenic
972231493 4:37077637-37077659 TCATTACTATAAACTATTTTTGG - Intergenic
972865460 4:43226777-43226799 TTATTACTATGAAATTTTTTAGG - Intergenic
973087480 4:46083773-46083795 TTATTCCAATGTGCTGTGTTTGG - Intronic
973168485 4:47108980-47109002 TTATTACTTTGAGCTGCTTTGGG + Intronic
973217948 4:47692331-47692353 TTATTACAATGTACTTCTTCAGG + Intronic
973304415 4:48629301-48629323 TTATTTCACTGTTCTGTTTTAGG - Intronic
973535323 4:51876053-51876075 TTATAACCATGTACTTTTTTTGG + Intronic
973712015 4:53639612-53639634 TAAGTAGAATGGACTGTTTTGGG + Intronic
974721225 4:65741160-65741182 AAATTACAATTAACTTTTTTGGG - Intergenic
976335205 4:83877488-83877510 TTAGTACAATAAAGTGTTTCAGG - Intergenic
976549398 4:86377578-86377600 TTTTTACTATGAACTCTTCTGGG - Intronic
976819047 4:89184386-89184408 TTAATAGAATGTAATGTTTTTGG - Intergenic
977809260 4:101340367-101340389 TTATTAAAATGCTATGTTTTTGG - Intronic
978130858 4:105195638-105195660 TTATTACACTGTATTGTTTAGGG + Intronic
978440040 4:108724417-108724439 TTTTTACCTTGAACTGGTTTTGG + Intergenic
978911992 4:114075002-114075024 TTATTTCAATGGTCTCTTTTTGG - Intergenic
978993848 4:115124785-115124807 TTGTTACACTGTACTGTTTAAGG - Intergenic
979783867 4:124690658-124690680 TTACTACAATTAACTGCTGTAGG + Intronic
980487406 4:133476494-133476516 TTATTACAATGAAAGCTTGTTGG - Intergenic
981681707 4:147406995-147407017 TTATTACAATGTACAACTTTAGG - Intergenic
981850787 4:149228116-149228138 TTAATAGAATGAACTCTTTGTGG + Intergenic
983003278 4:162447491-162447513 CTAATACAATTAACTGTTTCAGG - Intergenic
983024802 4:162722245-162722267 TTATTTAAATTAACTATTTTTGG - Intergenic
983350181 4:166576934-166576956 AAATTACAATGATATGTTTTGGG + Intergenic
984166574 4:176309548-176309570 TTATTAAAATGACAGGTTTTGGG - Intergenic
984272194 4:177560326-177560348 GTATTCCAAAGATCTGTTTTAGG + Intergenic
984388838 4:179100984-179101006 TTATTGCCATAACCTGTTTTGGG - Intergenic
984638137 4:182136173-182136195 TAATTGCATTGAAATGTTTTAGG + Intergenic
984996724 4:185439082-185439104 TGATTATAATGTAATGTTTTAGG - Intronic
985362567 4:189191438-189191460 TGATTTCAAATAACTGTTTTGGG + Intergenic
985385342 4:189440613-189440635 TTATTATAATCAACAGTTTAAGG + Intergenic
985722231 5:1495436-1495458 TTATTACAGTGAGCTGTTTCTGG + Intronic
985985059 5:3508503-3508525 TTATTATAATTAGGTGTTTTGGG - Intergenic
986914511 5:12601322-12601344 TTAGTACAATGCTCTGTATTAGG + Intergenic
988952974 5:36283723-36283745 TTTTTATAATGACCTGTTTAAGG - Intronic
988988887 5:36649938-36649960 GTATTATAATTAATTGTTTTTGG - Intronic
989135437 5:38149747-38149769 TAATAATAATGAAATGTTTTTGG + Intergenic
989244024 5:39233151-39233173 TTTTTAAAATGAAATGTTTATGG - Intronic
989313872 5:40054110-40054132 GGATTACAATGAACAGGTTTGGG - Intergenic
989419352 5:41218348-41218370 TTACTGCAAGGAACTGTTCTAGG + Intronic
989580126 5:43024808-43024830 TTTTTACAATGACCTGTTGTGGG + Intergenic
990153133 5:52843172-52843194 TTTTTACAGTGAATGGTTTTAGG - Intronic
990193896 5:53291042-53291064 TTTTTACAAACAACTGTTTCAGG - Intergenic
990685329 5:58294482-58294504 TTATATCAATGAATTGCTTTAGG - Intergenic
990815097 5:59775592-59775614 GTAATACAATGAACAATTTTGGG - Intronic
992303623 5:75411148-75411170 TAATTACAATGAAGTCTTTTAGG + Intronic
993056546 5:82987584-82987606 TTCTTGCAATGAATTGCTTTTGG - Intergenic
994655615 5:102589975-102589997 TTAGTAAAATGAACTGTAATTGG + Intergenic
994731334 5:103495104-103495126 TTATTAGTTCGAACTGTTTTTGG + Intergenic
994978083 5:106837109-106837131 TTTGTACAATCAACTATTTTGGG + Intergenic
995073445 5:107951978-107952000 TTATGAGAATTTACTGTTTTGGG - Intronic
995305118 5:110637235-110637257 ATATTACCAATAACTGTTTTGGG - Intronic
996167401 5:120242230-120242252 AAAATACAATGAAATGTTTTTGG - Intergenic
996852175 5:127965407-127965429 TTGTTTCTATGAAGTGTTTTAGG - Intergenic
997939634 5:138145433-138145455 TTATTACAATATACTGATTTAGG + Intronic
998897865 5:146819146-146819168 TTTTGAAAATGAACTATTTTGGG + Intronic
999038613 5:148382514-148382536 TTATTACAATGATTTGTGGTAGG + Intergenic
999585069 5:153080998-153081020 TTATTACAATGCAGGCTTTTGGG - Intergenic
999927143 5:156391543-156391565 TTATTACACTGTATTGTTTAGGG - Intronic
1000588185 5:163125675-163125697 TAATTACAATGATCAGATTTTGG - Intergenic
1002572251 5:180148012-180148034 ATATTTTAATGACCTGTTTTGGG + Intronic
1003077047 6:2991511-2991533 TTATTACAATGTTCTATCTTTGG + Intronic
1003210852 6:4065256-4065278 TTCTTTTAAGGAACTGTTTTTGG + Intronic
1004842713 6:19605704-19605726 TTATAACAATGCACTGTCTCAGG + Intergenic
1007239752 6:40416507-40416529 TTCTTACACTGGACTTTTTTTGG + Intronic
1007746755 6:44047855-44047877 ATATCACAATGTACTTTTTTGGG + Intergenic
1008549443 6:52613640-52613662 TTATGAGAATGAATTGCTTTTGG + Intergenic
1008818083 6:55593705-55593727 TTATTTCAATCAACTGTCTAAGG - Intergenic
1010379738 6:75210327-75210349 TTTTTACAATCAGCTTTTTTAGG - Intergenic
1010411486 6:75566812-75566834 GTTCTAGAATGAACTGTTTTGGG - Intergenic
1010748458 6:79590959-79590981 TTAATACTTTGAAATGTTTTAGG - Intergenic
1013620452 6:111883035-111883057 TTATTTCAATGAATTGGCTTTGG + Intergenic
1013775823 6:113677282-113677304 TTATTTCAATGGTCTGTGTTGGG - Intergenic
1013994131 6:116287388-116287410 TTTTTAAAAAGAACTCTTTTAGG - Intronic
1014399430 6:120968905-120968927 TTATTACTTCTAACTGTTTTGGG - Intergenic
1014647073 6:123987365-123987387 TTTTTCTAATGATCTGTTTTTGG + Intronic
1015384424 6:132605863-132605885 TTTATCCAATCAACTGTTTTTGG - Intergenic
1015429728 6:133116878-133116900 AGATTACAATGTTCTGTTTTAGG + Intergenic
1015615077 6:135066062-135066084 TTAAAACACTGAACTGTTTGAGG + Intronic
1015869042 6:137757217-137757239 TAATTATAATAAACTGATTTTGG + Intergenic
1015968655 6:138721220-138721242 TCATTATACTGAACTGTTTAGGG + Intergenic
1016035793 6:139381534-139381556 TTTTTTCAATGAACTTTCTTTGG - Intergenic
1016930640 6:149404091-149404113 TTATTACTTTTAACAGTTTTTGG - Intronic
1017300380 6:152850706-152850728 TTATTACAAAGATCTGGATTCGG - Intergenic
1018020410 6:159758148-159758170 GTATTACACTTAACTGATTTGGG + Intronic
1018101195 6:160442083-160442105 ATTTTAAAATGAACTGTTTTAGG - Intronic
1018300778 6:162400325-162400347 TTATTAAAATGATCAGTTTGTGG + Intronic
1018330815 6:162726091-162726113 TTATTAGGATGAAATGTGTTTGG - Intronic
1018448277 6:163878747-163878769 TTGTTTCAACGCACTGTTTTAGG - Intergenic
1018626652 6:165785690-165785712 CTAATAAAAAGAACTGTTTTTGG - Intronic
1020527185 7:9276577-9276599 TTCATACAATGAAATATTTTTGG - Intergenic
1021315177 7:19140214-19140236 TGATTACAATAAACTGCTTTAGG - Intergenic
1021543528 7:21787361-21787383 TTATTGCAATGAACCCATTTTGG - Intronic
1021691081 7:23231254-23231276 TAATGTCAATGAACTGTTTAAGG - Intergenic
1021698888 7:23299003-23299025 TCAGTACCAGGAACTGTTTTAGG + Intronic
1022017715 7:26366466-26366488 AAAATACAATGAAATGTTTTCGG - Intronic
1022265752 7:28752722-28752744 TTACTACAATGGCCTCTTTTAGG + Intronic
1022581780 7:31562606-31562628 TCACAACAATGATCTGTTTTAGG + Intronic
1023278311 7:38544213-38544235 TTAATACAATAACCTATTTTGGG - Intronic
1023404409 7:39817022-39817044 TTTTTACAATGACCTGTGTAAGG + Intergenic
1023771900 7:43564961-43564983 TTACTAAAATCAATTGTTTTAGG - Exonic
1026480388 7:70773783-70773805 TTATTGCAGTGAAATGTTCTGGG + Intronic
1027565331 7:79784784-79784806 TTAATACAAGGAACTGGTTTTGG - Intergenic
1027576372 7:79935917-79935939 TAATTACATTGAACAGCTTTTGG - Intergenic
1027658051 7:80956087-80956109 CAACTTCAATGAACTGTTTTTGG - Intergenic
1030198131 7:106873500-106873522 TTGTTACACTGTACTGTTTAGGG - Intronic
1030464014 7:109876822-109876844 TTATTTTAATTAGCTGTTTTGGG + Intergenic
1031043985 7:116866509-116866531 GAATGAAAATGAACTGTTTTTGG - Intronic
1031381745 7:121094522-121094544 TTCTAACAATGAACTTGTTTTGG - Intronic
1031707026 7:124993816-124993838 TTATTATAAGATACTGTTTTAGG - Intergenic
1031955499 7:127938242-127938264 TTAACACAATGAACAGATTTGGG + Intronic
1032606165 7:133356258-133356280 TTATTAGACTGCTCTGTTTTGGG + Intronic
1033835527 7:145306053-145306075 TTATAAAAATGAACTTTTATAGG - Intergenic
1037379646 8:18271124-18271146 TTATTAGTTTGAACAGTTTTTGG - Intergenic
1039029755 8:33296651-33296673 TTACCACCATGATCTGTTTTTGG + Intergenic
1042887435 8:73567957-73567979 TTATTATAATGTACCCTTTTTGG - Intronic
1044818354 8:96136251-96136273 TTGTTACACTGTACTGTTTAGGG + Intergenic
1045076825 8:98578659-98578681 TTTTTAAAATGAACTTTTATGGG + Intronic
1045579293 8:103461329-103461351 TTATTAAAATGAAGTGGCTTGGG + Intergenic
1046085912 8:109434901-109434923 TTATGACAATAGTCTGTTTTGGG + Intronic
1046297826 8:112245100-112245122 TTATTAAAATGTACTTTTATTGG - Intronic
1046405461 8:113767094-113767116 TTATTACAATATTATGTTTTTGG + Intergenic
1046944967 8:119966071-119966093 TTGTTACATTGTACTGTTTAGGG - Intronic
1047385338 8:124404254-124404276 TAATTACAATGAACTATTTGGGG + Intergenic
1049286570 8:141778655-141778677 TTTTAAAAATGAACTTTTTTTGG - Intergenic
1050335507 9:4586154-4586176 TTTTTTCAATGTACTGTATTGGG + Exonic
1050389898 9:5131245-5131267 TTATTACAGTGAGCTTTTATTGG + Intergenic
1051912349 9:22168393-22168415 TTTTCAGCATGAACTGTTTTAGG - Intergenic
1052109476 9:24563190-24563212 TTATTTCACTGAAATATTTTGGG - Intergenic
1052578599 9:30323500-30323522 TTAATACTATGAACTGTCCTTGG + Intergenic
1052746822 9:32449388-32449410 TTTTTATAGTGAAATGTTTTAGG - Intronic
1052813560 9:33082683-33082705 TAATTGCAATGAACAGTTTTGGG + Intergenic
1053156586 9:35785080-35785102 TTATTATGATGAATTATTTTAGG - Intergenic
1053335945 9:37271414-37271436 TTATTACAATGGACCTTTTTGGG + Intronic
1053385716 9:37686146-37686168 GTATTACAAGGAACTGTTGAAGG + Intronic
1055200463 9:73653086-73653108 TTATTATTATTAACTATTTTTGG - Intergenic
1056106251 9:83349511-83349533 CTCTTACACTGAATTGTTTTGGG - Intronic
1056260298 9:84841836-84841858 TTATTACAATGAACTGTTTTAGG - Intronic
1058400990 9:104619044-104619066 ATATCACAAAGAAGTGTTTTGGG - Intergenic
1058589310 9:106545467-106545489 TTATTAAAATAATCTATTTTAGG - Intergenic
1060438853 9:123619245-123619267 TTATTATAAAAAACTTTTTTAGG - Intronic
1060460070 9:123843917-123843939 TTATTACATTAATCTATTTTTGG - Intronic
1061797564 9:133096989-133097011 CTATCAGAATAAACTGTTTTGGG - Intergenic
1185978944 X:4754854-4754876 TAATTAAAATGAGCTATTTTTGG - Intergenic
1186038279 X:5448184-5448206 TTATTTCCATTTACTGTTTTTGG + Intergenic
1186269813 X:7874497-7874519 TAATTACATTTAAGTGTTTTAGG - Intergenic
1186553154 X:10528233-10528255 TTATTAAAATTAACTTTTCTTGG - Intronic
1187734803 X:22292686-22292708 GTATTACAATTAACTGTTTATGG - Intergenic
1187925003 X:24241636-24241658 TGATTACAATGATATATTTTAGG + Intergenic
1188351134 X:29132175-29132197 TTATTAAAGTGGACTTTTTTTGG - Intronic
1188618620 X:32191788-32191810 TTATTACATTGTACTGTTTAGGG + Intronic
1188726176 X:33585425-33585447 TTCTTCCACTCAACTGTTTTAGG + Intergenic
1189024440 X:37377205-37377227 CTATTTAAATGAATTGTTTTTGG + Intronic
1189997178 X:46650281-46650303 TTATTAAAGTGAACTTTTCTGGG - Intronic
1191672402 X:63760435-63760457 TTATTGAATTGAACTGATTTTGG - Intronic
1191754470 X:64579684-64579706 TTATTATAAGGAACTGTGTATGG + Intergenic
1191836459 X:65468971-65468993 TTCTTACAATGACCTGGCTTAGG - Intronic
1192160379 X:68782004-68782026 TTACCACCATGACCTGTTTTTGG - Intergenic
1192161469 X:68791345-68791367 TTACCACCATGACCTGTTTTAGG + Intergenic
1192205299 X:69091806-69091828 TTATTTCAATGAACGTTTATGGG + Intergenic
1192231460 X:69267956-69267978 TTACCACCATGACCTGTTTTTGG - Intergenic
1192239338 X:69316956-69316978 TTACCACCATGACCTGTTTTTGG + Intergenic
1193658617 X:84228986-84229008 TTATTACAGTGATTTGTTTTTGG - Intergenic
1193964629 X:87970070-87970092 TTATTACCATAAGCAGTTTTGGG - Intergenic
1194754877 X:97727021-97727043 ATTATCCAATGAACTGTTTTAGG - Intergenic
1195539506 X:106046621-106046643 TTGTTACAATCTACTGGTTTAGG - Intergenic
1195556818 X:106236083-106236105 TTATTACATTGAAGTGTATCGGG - Intergenic
1196595900 X:117545243-117545265 TTGTAACAAAGATCTGTTTTGGG - Intergenic
1197893931 X:131290948-131290970 TTACTACAATGAAGGGTTTGGGG + Intronic
1197994561 X:132359196-132359218 TAATTATAATGAAATGTTTATGG - Intergenic
1199543634 X:148984710-148984732 TTATTACACTGAAGTGTTATTGG - Intronic
1199880265 X:151968809-151968831 TAATTACAATGAAATGATGTAGG + Intronic
1200773993 Y:7153237-7153259 TTTTTAAATTGAACTTTTTTTGG - Intergenic