ID: 1056260301

View in Genome Browser
Species Human (GRCh38)
Location 9:84841889-84841911
Sequence AACATCCCAGGTTGAATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056260298_1056260301 30 Left 1056260298 9:84841836-84841858 CCTAAAACAGTTCATTGTAATAA 0: 1
1: 1
2: 0
3: 36
4: 398
Right 1056260301 9:84841889-84841911 AACATCCCAGGTTGAATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056260301 Original CRISPR AACATCCCAGGTTGAATCTA GGG Intronic
No off target data available for this crispr