ID: 1056261216

View in Genome Browser
Species Human (GRCh38)
Location 9:84850754-84850776
Sequence CGTTTCTGCCTCAGAACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056261216_1056261219 -8 Left 1056261216 9:84850754-84850776 CCCTCTGTTCTGAGGCAGAAACG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1056261219 9:84850769-84850791 CAGAAACGCCCTTTTGGTGTTGG No data
1056261216_1056261220 -7 Left 1056261216 9:84850754-84850776 CCCTCTGTTCTGAGGCAGAAACG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1056261220 9:84850770-84850792 AGAAACGCCCTTTTGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056261216 Original CRISPR CGTTTCTGCCTCAGAACAGA GGG (reversed) Intronic
905417497 1:37814218-37814240 ATTTTCTTCCTCAGAGCAGAAGG - Exonic
911521229 1:98933054-98933076 CATTTCTACCTCAAAACAGATGG + Intronic
913352601 1:117878107-117878129 CTTTTCTGTCTCAGGACTGAAGG - Exonic
914255806 1:145960762-145960784 AGTTTCTGCCTCAGCCCTGAAGG + Exonic
920160654 1:203995533-203995555 TCTTTCTGCCTCACTACAGATGG - Intergenic
920265810 1:204721788-204721810 AATGTCAGCCTCAGAACAGAGGG + Intergenic
922447092 1:225706784-225706806 CCTTTCTGCGTCAGAAGAGGAGG - Intergenic
924113166 1:240720233-240720255 CGCTTCTGTCTCAGAAAACAGGG - Intergenic
1062816469 10:504770-504792 CTTTTCAGCTTCATAACAGAAGG + Intronic
1063514751 10:6684769-6684791 CCTTTCTGCTGCAGAACAGATGG + Intergenic
1065358807 10:24869743-24869765 CCTTTCTGCCTCAACAAAGAGGG + Intronic
1069674143 10:70235134-70235156 CTTTTCTGCCTTTGAGCAGATGG + Intergenic
1069743658 10:70701192-70701214 AGATGCAGCCTCAGAACAGAAGG + Intronic
1070718591 10:78740391-78740413 GGTTTCTGCCTCAGGCCAGTTGG - Intergenic
1073990660 10:109258661-109258683 GTTGTCTACCTCAGAACAGAAGG - Intergenic
1074764679 10:116691874-116691896 CATGTCTGCCGCAGAAAAGAAGG - Intronic
1075818200 10:125282759-125282781 CGTTTCTTCCTCAGCACTGTGGG - Intergenic
1076102871 10:127797269-127797291 CCTTTCTTCCACAGGACAGAGGG - Intergenic
1078022695 11:7668784-7668806 CTCTTTTTCCTCAGAACAGAAGG - Intronic
1078102555 11:8338374-8338396 AGCTTTGGCCTCAGAACAGATGG + Intergenic
1078502190 11:11891368-11891390 TGTTACTGCTTCAGTACAGATGG - Intronic
1079617835 11:22516886-22516908 CTTTTCTGGGTCAGCACAGATGG - Intergenic
1080390363 11:31840355-31840377 GGTTTTAACCTCAGAACAGAAGG + Intronic
1080754094 11:35178906-35178928 GCTTTCTGCCACAGGACAGATGG + Intronic
1080804709 11:35641862-35641884 TGTATTTCCCTCAGAACAGATGG + Intergenic
1080894060 11:36434472-36434494 CTTTTCTGCATCAGTAAAGAAGG - Intronic
1082660618 11:55905471-55905493 CTTTTATGTCACAGAACAGAGGG - Intergenic
1086094849 11:83040185-83040207 CATTTCTGTCTTAGAGCAGAAGG - Intronic
1087139823 11:94754304-94754326 CATGTATGCCTCAGAACAGCTGG + Intronic
1089197528 11:116703419-116703441 CTTTTCTGCCTCCAAACACAAGG - Intergenic
1089701148 11:120244773-120244795 CGTTTCTCCATTGGAACAGAAGG + Intronic
1090330472 11:125927325-125927347 TGTTTCTACCTCAGCAGAGATGG - Intergenic
1090627741 11:128620668-128620690 AGTTGCTGCCCCAGAACAGCTGG - Intergenic
1091156299 11:133377344-133377366 CATTCCAGCCTCAGAACAGCAGG - Intronic
1094526663 12:31235578-31235600 CCTGTTGGCCTCAGAACAGAGGG - Intergenic
1095787345 12:46124103-46124125 AGCTCCTGCCTCAGAAGAGAAGG - Intergenic
1096037254 12:48483278-48483300 GGTTTCTGTCTGAGAACAAATGG + Exonic
1098504024 12:71227693-71227715 AGTTTGTGGCTCAGCACAGAGGG + Intronic
1098517349 12:71392636-71392658 GTTTTATGCCTCAGAAAAGAGGG - Intronic
1098575518 12:72037658-72037680 AGCTTCTGCCTGAGAACAGAGGG + Intronic
1103471783 12:121187850-121187872 CCTTTCTGTGTCAGAAGAGAAGG + Exonic
1108061212 13:46535194-46535216 AGTCTCTGCATAAGAACAGATGG + Intergenic
1111756476 13:92402582-92402604 CTGTTCTGCCTCAGAACATCAGG + Intronic
1114610070 14:24034266-24034288 CGTGTCTACCTCTGAAGAGAAGG + Intergenic
1114967849 14:27985364-27985386 TATTTCTGCCACAGAAAAGATGG + Intergenic
1115465702 14:33712007-33712029 CTCTTCTGCCTGAGAACAAACGG - Intronic
1116427788 14:44811214-44811236 AATTTCTTCCTCAGATCAGATGG + Intergenic
1117388719 14:55242804-55242826 CGTTTCTGCCACCTAACAGTTGG - Intergenic
1119907066 14:78315396-78315418 AGTTCCTGCCTCAGAACTGTAGG + Intronic
1122233759 14:100320619-100320641 TATTTCTGCCTCAGAGAAGAGGG + Intergenic
1122928990 14:104924785-104924807 TGTTTCTGTCTCAGATGAGAGGG + Intergenic
1123905806 15:24920228-24920250 CGTTTCTGATTCAGAAAAAAAGG - Intronic
1127568651 15:60218498-60218520 ACTTTCTGCCTCAGAACAAAAGG + Intergenic
1127807248 15:62532802-62532824 CAGTTCTTCCTCAGAACAGTGGG + Intronic
1132151696 15:99466900-99466922 AGCTTCTGACTCAGATCAGACGG + Intergenic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1137280008 16:46968469-46968491 GGCTTATGCCTCAGAACAGAAGG - Intronic
1138345373 16:56317075-56317097 CTTTTCAGCCTCAGAACTCAGGG - Intronic
1139290034 16:65849662-65849684 TGTTTCTGCCTCATAAAAGTGGG - Intergenic
1139905319 16:70361573-70361595 TTTTTGTGCCTGAGAACAGAAGG + Intronic
1141387016 16:83631037-83631059 CATCTCTGCCGCAGAACAGCTGG + Intronic
1141897353 16:86966754-86966776 CGTTTCTGCATCAGTAAAGTGGG - Intergenic
1142408960 16:89906635-89906657 CGTTTCTGTCTCAAAACCTAAGG + Intronic
1142876838 17:2856372-2856394 GGTTTCTGCCTCACCACAAAGGG + Intronic
1147583657 17:41640119-41640141 CATCTCTGCCTCAGAACCCAGGG + Intergenic
1148581165 17:48744956-48744978 GGTTCCTGCCCCAGAAAAGAGGG + Intergenic
1151100045 17:71545883-71545905 AGTTTCTGAATAAGAACAGAAGG - Intergenic
1152771726 17:82173904-82173926 CGCTTCTGCCTCTGACCAGGAGG + Intronic
1157814519 18:50721143-50721165 CATTTCTGGCTCTGGACAGATGG - Intronic
1158106359 18:53889009-53889031 GGTCTCTGCCTCAGACCACAGGG - Intergenic
1159090770 18:63846205-63846227 CATTTTTGCCTCAGAGAAGATGG + Intergenic
1159458938 18:68697234-68697256 CTTTTCTGCCTCAGAAGAAGTGG - Exonic
1160311434 18:77794655-77794677 CTTTTCTGCCTCACATCAGTGGG + Intergenic
1163744425 19:19036657-19036679 CCTTTCTGCCCCAGAAGAAAAGG - Intronic
1165700884 19:37936640-37936662 TGTTTCTGCCTCTGAGAAGAGGG - Intronic
1166523987 19:43499531-43499553 CATTTCTGTCTCAGGAGAGAGGG + Intronic
925029910 2:642447-642469 CATTTCTGCCCCAGCTCAGAAGG + Intergenic
927738826 2:25548470-25548492 GGCTTCTTCCTAAGAACAGAAGG + Intronic
929411094 2:41697965-41697987 CTTGTCTGCCTCAGAACAATGGG - Intergenic
931910259 2:66891454-66891476 TTTTTCTGCCTCACAACACATGG + Intergenic
932336441 2:70934028-70934050 CATTTCAGCCTGACAACAGAGGG + Intergenic
932416298 2:71575574-71575596 CCTTTCTGACTCAAAGCAGAGGG - Intronic
933516811 2:83314379-83314401 AGTTACTGCTTCAGACCAGATGG + Intergenic
933575216 2:84059445-84059467 CTTTTCCCCTTCAGAACAGAAGG + Intergenic
936290758 2:111222218-111222240 TGTCTCTGCCTCAAGACAGAGGG - Intergenic
937206960 2:120243043-120243065 GGTTTCTGCATCAGAACGAAGGG - Intronic
938369420 2:130760078-130760100 CTTTTCTGCCTCATGCCAGATGG - Intronic
938573027 2:132579616-132579638 ATTTTCTGCCTAAGACCAGAAGG - Intronic
949057057 2:241933355-241933377 TGTGTCTGCCCCAGAACAGGAGG + Intergenic
1168961583 20:1873750-1873772 CTTATATGCCTCAGAAGAGATGG - Intergenic
1169841598 20:9943967-9943989 AGTTTCTCCCCCAAAACAGATGG - Intergenic
1170593898 20:17791424-17791446 CTTTTCTCCCTCCGCACAGATGG + Intergenic
1172468940 20:35176602-35176624 CGTTTCTGCCCCAGAGGAAAGGG - Intronic
1174277016 20:49411228-49411250 CGTTTCTTCATCTGAACATAGGG - Intronic
1176010661 20:62892656-62892678 CGTTTCTGCATCCAGACAGACGG + Intronic
950624751 3:14236908-14236930 GGTTTCAGCCCAAGAACAGAAGG + Intergenic
952272744 3:31848600-31848622 CATTTCTGCCCCAGAATAAATGG + Intronic
953338414 3:42113422-42113444 CCTCTCTGCCTCAAAAAAGAAGG - Intronic
954967880 3:54626874-54626896 CGTTTCTGCTTCCCAACAAAGGG - Intronic
956403076 3:68900442-68900464 TGTGTTTGCCTCTGAACAGAAGG - Intronic
956736901 3:72245162-72245184 CATTTTTCCCTCAGAGCAGATGG - Intergenic
965173884 3:165304650-165304672 CGTGTCTCTCTCATAACAGATGG - Intergenic
966101473 3:176274263-176274285 TGTTCCAGCCTCAGAAGAGAGGG + Intergenic
966783053 3:183601586-183601608 CCTTGCTTCCCCAGAACAGAGGG + Intergenic
967158776 3:186717414-186717436 CCTCTCTGCCTCAGAACTCAGGG - Exonic
968504345 4:965002-965024 TGTTTGTGCCTCACAACAGCAGG - Intronic
970562610 4:17297728-17297750 CGTTTGTGTCTCAGCTCAGAGGG - Intergenic
975395749 4:73871164-73871186 TGTTTCTGGCTTAGAACAAAGGG + Exonic
979347619 4:119607056-119607078 CCTCTCTGACTCAGAAAAGAAGG - Exonic
981546749 4:145902055-145902077 TATTCCTGCCTCAGATCAGATGG + Intronic
981582976 4:146269263-146269285 GGTTTCTGCCTCAGAAGATCAGG + Intronic
983354109 4:166633134-166633156 CTGTTCTGCCTCAGAACATCAGG + Intergenic
986323507 5:6653498-6653520 CCTTTCTGCCTCAGAGAACATGG - Intronic
990890840 5:60648215-60648237 CTTTCCTGCCTCAAAACAGTAGG + Intronic
990985748 5:61639367-61639389 CCCTTTTGCCACAGAACAGAGGG + Intronic
991319805 5:65359672-65359694 CTATTCAGCCTCAAAACAGAAGG + Intronic
991515311 5:67428423-67428445 CGTTTATGCCTCAGAGTAGATGG - Intergenic
994526187 5:100907724-100907746 AGTTTCTTTCACAGAACAGAGGG + Intergenic
994614819 5:102091084-102091106 CCTCTCTGCCTGAGGACAGATGG - Intergenic
997114942 5:131116331-131116353 AGTCTCTGGCTCAGAAGAGAAGG - Intergenic
1002344513 5:178538042-178538064 CGATTCAGCCTCAGAAAGGAAGG - Intronic
1003978880 6:11370796-11370818 TGTTTCTGCCTCTGAACCGTTGG - Intronic
1004481022 6:16019379-16019401 CATTCCTGCCTGAGAAAAGAAGG + Intergenic
1007567496 6:42863640-42863662 GGTTTCTTCCTTAGAGCAGAAGG - Intronic
1009991399 6:70846799-70846821 TGTTTCTGCCTGAGAACACCAGG + Intronic
1009996637 6:70902699-70902721 CTATTCTGCCTTAGAAAAGAAGG + Intronic
1010427809 6:75746469-75746491 CTTTTGTGTCCCAGAACAGACGG - Intergenic
1012837510 6:104288619-104288641 CGTTTCTTGCTCAGACCTGAAGG + Intergenic
1013709525 6:112880385-112880407 AGTTTCTGCCCCAAATCAGAAGG + Intergenic
1013881582 6:114908780-114908802 TGTTTAATCCTCAGAACAGAAGG + Intergenic
1013958973 6:115874938-115874960 AGTTTCTGCATCAGAAAAGGAGG + Intergenic
1015284245 6:131466792-131466814 CACTTCTGCCACAGAAAAGAGGG - Intergenic
1017785254 6:157751609-157751631 CTATTCTGCCTTAGAAAAGAAGG + Intronic
1019171427 6:170135347-170135369 CGTTTCTACCTTAGAAATGATGG + Intergenic
1019557809 7:1641312-1641334 CCTTCCTGGCTCAGAACAGCCGG + Intergenic
1027939593 7:84657906-84657928 TATTTCTGCCTCAGAAAACAAGG + Intergenic
1028762584 7:94510826-94510848 CGTTTCTGCATCACAAAAGCTGG - Intronic
1035542543 8:453094-453116 CCTCTCTGCCTCAGCACAGAAGG + Intronic
1035966950 8:4203141-4203163 CTTTTCTGGCTCAGGTCAGAGGG + Intronic
1036581888 8:10082481-10082503 CTTTTCTCCCACAAAACAGATGG + Intronic
1037414087 8:18630108-18630130 TGTTCCTGCCTCAGAACCAAAGG - Intronic
1038489184 8:27957587-27957609 AGATTCTGCCTCAGACCAGGAGG + Intronic
1041437224 8:57855579-57855601 TGCTTCTGCCTGAGAACAGCCGG + Intergenic
1043506631 8:80909229-80909251 GGTTTCTGCCTCAGGAAAGCTGG + Intergenic
1046805216 8:118472797-118472819 CATTGCTGACTCAGAATAGAAGG + Intronic
1047212595 8:122851863-122851885 CATTTCTGCCTCATGACAGATGG - Intronic
1047349593 8:124061015-124061037 AGTTTCTAACTCAGAACAGCCGG - Intronic
1051341831 9:16119300-16119322 GGTTTCTGCCTCATCACAGGAGG - Intergenic
1052787520 9:32843483-32843505 TGGTTCTGCCTCATCACAGATGG + Intergenic
1052923075 9:33988627-33988649 TGTGTCTGACTCATAACAGAAGG + Intronic
1053043698 9:34895802-34895824 CATTTCTGCCTCACAGAAGAGGG + Intergenic
1056261216 9:84850754-84850776 CGTTTCTGCCTCAGAACAGAGGG - Intronic
1057670012 9:97078440-97078462 CGTTTGTGGGTCAGAACTGATGG + Intergenic
1057840008 9:98478657-98478679 GGTTTCTGCTTCTGAACAGATGG - Intronic
1059234097 9:112747732-112747754 CGTTTCTCCATCAGAGCAGAAGG - Intergenic
1059339229 9:113588038-113588060 CCTATCTGGCTCAGCACAGAGGG + Intronic
1060299184 9:122364423-122364445 GGTTCTTGCCTGAGAACAGAAGG + Intergenic
1060375403 9:123112095-123112117 CGTTGCTGCCCCAGCACAGTCGG - Intronic
1060752254 9:126179933-126179955 AGTATCTGCTTCAGAACTGAAGG - Intergenic
1062481477 9:136754472-136754494 AGTTCCTGCCTCAGACCACAAGG - Exonic
1188726241 X:33586625-33586647 CATTTCTGCCTTAGTGCAGAAGG - Intergenic
1189257964 X:39654835-39654857 CCTCTCTGCCTGAGAGCAGATGG - Intergenic
1190561164 X:51686685-51686707 CCTTTCTGCTTCAGCAGAGAGGG - Intergenic
1190563127 X:51706632-51706654 CCTTTCTGCTTCAGCAGAGAGGG + Intergenic
1192739304 X:73877311-73877333 CTTTACTGCCTCAGAAGAGGGGG + Intergenic
1197585294 X:128339371-128339393 CTTTCCAGCCTCTGAACAGAAGG - Intergenic
1198326540 X:135579254-135579276 CTTTTCTGACACAGAAAAGAAGG + Intronic
1199478388 X:148271449-148271471 AGTCTCCGCCTCAAAACAGATGG - Intergenic
1200244048 X:154513300-154513322 CCCTTCTCCCTCAGAACAGGAGG - Intronic
1200367659 X:155684372-155684394 CCCTTCTCCGTCAGAACAGAAGG + Intergenic