ID: 1056266485

View in Genome Browser
Species Human (GRCh38)
Location 9:84901760-84901782
Sequence ATGGAGAAGAAGCCAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 856
Summary {0: 1, 1: 0, 2: 9, 3: 92, 4: 754}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056266485 Original CRISPR ATGGAGAAGAAGCCAGGGGA GGG (reversed) Intronic
900033098 1:385436-385458 AGGAAGAAGAAGCCAGGGCCTGG - Intergenic
900053939 1:615326-615348 AGGAAGAAGAAGCCAGGGCCTGG - Intergenic
900096311 1:941523-941545 CTGGAGGAGAAGCCAGAGAAGGG + Intronic
900323400 1:2095853-2095875 AAGGAAAAGAAGGGAGGGGAAGG - Intronic
900381176 1:2384876-2384898 ATGGAGAAGCTGCCAGGGTGAGG + Intronic
900476761 1:2879723-2879745 ATGGAGAAGCAGACACGCGAGGG + Intergenic
900571776 1:3362169-3362191 ATGAAGACAAAGGCAGGGGAAGG - Intronic
900625691 1:3607573-3607595 ATGGAGAAGGTGGCAGGGGAAGG + Intronic
901276898 1:7998858-7998880 AAGTAGAAGAGGCCAGGTGAGGG + Intergenic
901438424 1:9263354-9263376 ATGGAAGAGATGCCAGGCGAGGG + Intronic
901520209 1:9777970-9777992 GGGGAGAAGACGGCAGGGGAGGG + Intronic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
902078810 1:13806991-13807013 GTGGAGGAGAAGACAGGGAAAGG - Intronic
902714900 1:18265885-18265907 CTGGAGAAAATGCCAGTGGAAGG - Intronic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
902837697 1:19057794-19057816 ATGGAGACCAGGCCATGGGAAGG + Intergenic
902887487 1:19416384-19416406 ATGGGGAAGAAGCCAGGATAGGG - Intronic
903127898 1:21260199-21260221 CTGGAGTGGAAGCCAGGGGGCGG + Intronic
903323079 1:22554079-22554101 ATGGAGAAGGAGCCAGGCTGTGG - Intergenic
904347463 1:29882540-29882562 ATGGAGAAGAAACCAGAGCAGGG + Intergenic
904413731 1:30342316-30342338 ACGGTGAAGAAGTGAGGGGAAGG - Intergenic
905029376 1:34871346-34871368 ATGGACAAGGAGCCAGGAGGAGG - Intronic
905325871 1:37151725-37151747 GTGGGGCAGAAGCCAGGAGAGGG - Intergenic
905540444 1:38756220-38756242 ATGGAAAAGAGGCCAAGGGTGGG - Intergenic
906070578 1:43013507-43013529 ATGGTGACAAAGCCTGGGGATGG + Intergenic
906127412 1:43435733-43435755 ATAGGGAAAGAGCCAGGGGAGGG + Intronic
906477933 1:46182333-46182355 ATGGAGAAGGAGCAGTGGGAGGG + Intronic
906509126 1:46400992-46401014 GAGGAGGGGAAGCCAGGGGAGGG + Intronic
906569541 1:46824982-46825004 AAGCAGAAGCAGCCATGGGAAGG + Intergenic
906852953 1:49271708-49271730 ATGGAGAAGAAGGAGGGGTAGGG - Intronic
907120713 1:52005722-52005744 ATGCTTAAGAAGCCAGGGAAAGG - Intergenic
907238361 1:53066899-53066921 AAGGAGAAGAATCCAGGGGAAGG - Intronic
907679697 1:56551567-56551589 AAGGAGAAGATGCCTGGGAATGG + Intronic
907799322 1:57749142-57749164 ATGGAGTGGAAGTGAGGGGAGGG + Intronic
908046609 1:60177150-60177172 AATCAGAAGAAGCCAGGGCATGG + Intergenic
908224330 1:62040747-62040769 ATGCAGTAGAAGCCACTGGAAGG + Intronic
909589497 1:77329850-77329872 GTGGAGAAGAAGCCAGGAACTGG + Intronic
909687566 1:78367979-78368001 AAGGAGAGGAGGGCAGGGGAGGG - Intronic
910105939 1:83631232-83631254 GTGGAGAAGGGGCCAGAGGAAGG - Intergenic
911365802 1:96936063-96936085 ATGGGGAAGAAAACAAGGGATGG + Intergenic
911372647 1:97012541-97012563 ATGGAGAAGTTCCCAGGAGAAGG + Intergenic
911718690 1:101166202-101166224 ATAGAGAAGAGGCCAGAGGATGG - Intergenic
912795166 1:112688945-112688967 ATGGAGGAGAAGCCAGGGGCGGG - Exonic
913206663 1:116545266-116545288 ATGGAGAGGAAGCCACAGAAAGG + Intronic
913567499 1:120087333-120087355 ATGGGGAAGAACCCAGGGCAGGG + Intergenic
913630636 1:120706213-120706235 ATGGGGAAGAACCCAGGGCAGGG - Intergenic
913715500 1:121530255-121530277 ATGGACAGGAAGCCAGGCGGGGG - Intergenic
914288247 1:146248040-146248062 ATGGGGAAGAACCCAGGGCAGGG + Intergenic
914549283 1:148698786-148698808 ATGGGGAAGAACCCAGGGCAGGG + Intergenic
914617401 1:149372932-149372954 ATGGGGAAGAACCCAGGGCAGGG - Intergenic
914915468 1:151816545-151816567 ATGGAGAGGAGACCAGAGGATGG + Intronic
914960121 1:152197567-152197589 AGGGAGAAGAAAGGAGGGGAAGG - Intergenic
915636222 1:157189039-157189061 GTGGAGATGAAGCAAGCGGAGGG + Intergenic
915664800 1:157434667-157434689 ACTGAGATAAAGCCAGGGGAGGG - Intergenic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916339430 1:163712697-163712719 ATTGAGAAGAAGCCTGGGCATGG + Intergenic
916495134 1:165339802-165339824 ATAGAGGAGAAGCCTAGGGAAGG - Intronic
917304065 1:173608902-173608924 AGGGAGAGGAAGGGAGGGGAAGG + Intergenic
917410661 1:174757010-174757032 ATGGACAAGAAGCTGGAGGAAGG - Intronic
917470782 1:175324173-175324195 ACAGAGTAGAAGCCAGAGGAAGG - Intronic
917967813 1:180189451-180189473 ATGCAGAAGAAGGCGGGGGGCGG - Intronic
918726288 1:187928600-187928622 AGAGAGAAGAAACAAGGGGAGGG - Intergenic
919808188 1:201393169-201393191 AAGGAGAAGAAACCAGCGAAAGG + Intronic
920221856 1:204410216-204410238 ATGGAAAAGGAGCCTGGAGAGGG - Exonic
920355921 1:205372456-205372478 ATGCTTAAGAAGCCAGGGAAAGG + Intergenic
921145176 1:212348362-212348384 AGGGAAAAAAAGGCAGGGGAAGG - Intronic
921301491 1:213755357-213755379 ATGGAGAAGGAAGCAGGGAAAGG + Intergenic
921789907 1:219278198-219278220 ATGGAAAAGAGTCCAGGGGTAGG - Intergenic
922036648 1:221854812-221854834 ATGGAGAAGAAGTCATGGAAGGG + Intergenic
922205228 1:223440625-223440647 ATGAAAAAGTGGCCAGGGGAAGG + Intergenic
922371832 1:224918989-224919011 ATTCAGAAGAAGCCAGGAAAAGG - Intronic
922573449 1:226646925-226646947 AGTGAGCAGAAGCCAGGGGCTGG - Intronic
922666453 1:227473731-227473753 ATGGAGAGCAAGCCAAAGGAGGG + Intergenic
923110902 1:230889240-230889262 AAAGAGCAGAAGCCAGGGGAAGG + Intergenic
923118113 1:230963266-230963288 ATGGTGAAGAAGCCCTGGGGTGG + Intronic
923145687 1:231196123-231196145 AGGAAGAATAAGCCAGGGGAAGG + Intronic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923565717 1:235074373-235074395 ATGGAGAAGAACCCAGGCGAAGG + Intergenic
924424078 1:243934144-243934166 AGGGAGAGGAAGGGAGGGGAAGG - Intergenic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
924606436 1:245539606-245539628 AAGAAGAAGAAAACAGGGGAAGG - Intronic
924688803 1:246324971-246324993 AAGGAGAAGGAGTCAGGGGGCGG + Intronic
1062812677 10:478091-478113 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062812685 10:478111-478133 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062812702 10:478151-478173 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062812759 10:478286-478308 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062812770 10:478311-478333 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062812778 10:478331-478353 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062812789 10:478356-478378 GGGGAGAAGAAGGGAGGGGAGGG + Intronic
1062930131 10:1347422-1347444 AATGAGAAGAAACCAGGGCACGG + Intronic
1063493936 10:6489689-6489711 ATGGAAAACAAACCAGGGCAGGG + Intronic
1063659277 10:8022465-8022487 ATGGAGAAAAGGCCAGGGGTAGG + Intergenic
1063851772 10:10200466-10200488 GGGGAGAAGGAGCTAGGGGAAGG - Intergenic
1063877859 10:10498639-10498661 ATGGGGAAGAGGCTAGAGGAAGG - Intergenic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1064691906 10:17927187-17927209 ACAGAAAAGAAGCTAGGGGAGGG + Intergenic
1064850277 10:19701737-19701759 AGGGAGAGGAAGGGAGGGGAGGG - Intronic
1066945634 10:41909289-41909311 ATGGAAAAAAAGCGAGGGAATGG + Intergenic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067150656 10:43730045-43730067 AAGAAGAAGAAGACAGGCGAGGG + Intergenic
1067196395 10:44123242-44123264 CTGGAGAAAAAGCCTGGAGAGGG + Intergenic
1067449966 10:46376130-46376152 TTTGAGAAGAGTCCAGGGGAGGG + Intronic
1067554304 10:47257470-47257492 ATGGTGGAGATGCCAGAGGAGGG + Intergenic
1067587278 10:47483633-47483655 TTTGAGAAGAGTCCAGGGGAGGG - Intronic
1069007822 10:63337507-63337529 AGGGAGGAGAAGGGAGGGGAAGG + Intronic
1069412716 10:68169626-68169648 CTGGAGAAGAAGCCAGTGTTTGG - Intronic
1069633398 10:69911191-69911213 ATTGAGAAGGGGCAAGGGGAAGG - Intronic
1069756335 10:70776284-70776306 ATGGAGAAGGGCCCAGGGGCAGG - Intronic
1069914225 10:71777544-71777566 AAGGAGAAGAAAGCAGGGGGTGG - Intronic
1070688238 10:78505668-78505690 CTGGAGAAGGAGACAGGGCAGGG + Intergenic
1070806290 10:79272962-79272984 CTGGAGAGGATGACAGGGGATGG + Intronic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1071411503 10:85401454-85401476 CTGAAGGAGGAGCCAGGGGAAGG + Intergenic
1074222412 10:111450992-111451014 AGGGAGAACATGCCAAGGGAGGG - Intergenic
1075301703 10:121330589-121330611 AGGGAGAGGAAGTGAGGGGAGGG - Intergenic
1075670907 10:124263643-124263665 AGGGAGAGGAGGCGAGGGGAGGG - Intergenic
1076152228 10:128171995-128172017 GGGGAGAAGAGGACAGGGGAGGG - Intergenic
1076241341 10:128910400-128910422 TGGGAGAAGTAGACAGGGGATGG - Intergenic
1076493346 10:130879148-130879170 ATGGAGCAGAAGGGAGTGGAAGG + Intergenic
1076522138 10:131087910-131087932 ATGAAGGAGGAGCGAGGGGAGGG + Intergenic
1077107563 11:848659-848681 AGGGAGAGGAAGCTAAGGGAGGG - Intronic
1077203215 11:1324502-1324524 AAGGAGAAGGAGGCAGTGGAAGG + Intergenic
1077225273 11:1436785-1436807 ATGGAGAGGAAGGGAGAGGAGGG - Intronic
1078131056 11:8614557-8614579 ATGGAGAAGAAGCCCAGGAAGGG + Exonic
1078451830 11:11446319-11446341 ATGGAAAGGAAGCCAAGGAAAGG - Intronic
1078639496 11:13081893-13081915 ATGGAAAAGAAGGCAGGAAAAGG - Intergenic
1078657520 11:13255581-13255603 GTGGACAAGAAGCCAGGTGGAGG + Intergenic
1079244174 11:18741080-18741102 ATGGAGGAGAGTCCAGGGTAAGG - Intronic
1080657219 11:34267380-34267402 ATGGGGAAGAGGCCAGGGTTGGG - Intronic
1080662066 11:34304695-34304717 ATGGAGGGGAAGGGAGGGGAGGG + Intronic
1080679894 11:34464669-34464691 ATGGAGAATAAGCCACGTGAAGG - Intronic
1080919052 11:36690285-36690307 GTGGAGCAAAAGCCAGAGGATGG - Intergenic
1081014054 11:37854062-37854084 ATGAAGATGAAGGCAGAGGAGGG + Intergenic
1081433178 11:42998730-42998752 ATGGAGACAAAGTGAGGGGATGG + Intergenic
1081586631 11:44389482-44389504 AAGGGGAAGATGCCAGGGGATGG - Intergenic
1083627302 11:64078285-64078307 CTGGAGAAGAGGCCAGGGCAGGG - Intronic
1083850574 11:65363960-65363982 ATGCAGAGCAAGGCAGGGGAGGG + Intergenic
1084005512 11:66321378-66321400 AAGGAGAAGAAAGAAGGGGAAGG + Intergenic
1084013588 11:66366091-66366113 GTGGAGAAGACGGCAGGGCAGGG - Intronic
1084270185 11:68025195-68025217 ATGGAGCAGAAGGCAGCAGAGGG - Intronic
1084534428 11:69748305-69748327 ATGGAGAAGAAAGAAAGGGAGGG - Intergenic
1084742730 11:71149993-71150015 ATGGAGAGGAAGGGAGAGGAAGG + Intronic
1084874233 11:72118974-72118996 AGGGAGCAGAAGCCAGGTGAAGG - Intronic
1085187009 11:74584097-74584119 ATGACGAAGAAGACAGAGGAGGG + Intronic
1085376893 11:76071875-76071897 ATGGAGAAAGATCCAGGAGATGG + Intronic
1085472414 11:76766757-76766779 ATGCACAAGCAGCCAGGGGCTGG + Intergenic
1085572994 11:77575706-77575728 ATGCTTAAGAAGCCAGGGAAAGG - Intronic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1086795517 11:91096485-91096507 AGGGAGAGGAAGGGAGGGGAGGG - Intergenic
1086805335 11:91234477-91234499 ATTGAGAAGAGTCCAGGGCATGG + Intergenic
1087913622 11:103781979-103782001 AATGAGAGGAAGCTAGGGGAGGG + Intergenic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1089016284 11:115168036-115168058 TTGCAGAAGAAGCCAGGTGTGGG - Intergenic
1089326999 11:117664107-117664129 TGGGAGAGGAGGCCAGGGGAGGG + Intronic
1089944020 11:122448547-122448569 ATGGGGTAGAAGGCAGGGGGAGG + Intergenic
1090748112 11:129723381-129723403 CTGCAGAAGAAGCTAGGAGAGGG - Intergenic
1090925963 11:131250794-131250816 ATGGAGACGATGACATGGGATGG - Intergenic
1091326339 11:134691392-134691414 ATGGAGAGGAAGGGAGAGGAGGG - Intergenic
1091366610 11:135026797-135026819 ATGGAGAAGAAGGTAGAGAAAGG - Intergenic
1091747369 12:3000939-3000961 ATGGTGAAGAAGCGGGGGGCAGG - Intronic
1091784204 12:3232473-3232495 AGGGAGCAGAAGGCAGGAGACGG - Intronic
1091832589 12:3560422-3560444 ATGTGGAAGAAGCCATGTGAAGG - Intronic
1091849592 12:3684443-3684465 GTGGAGGGGAAGGCAGGGGAGGG + Intronic
1091929183 12:4381106-4381128 TTGGAGAAGCAGCCTAGGGAAGG - Intergenic
1092078553 12:5693672-5693694 CTGGAGAAGAAGGAAGGAGAGGG - Intronic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1093311803 12:17597470-17597492 ATTAAGAAGAAGCGAGGAGAAGG + Intergenic
1093573360 12:20695313-20695335 AAGGAACAGAAGCCAGAGGAGGG - Intergenic
1093575850 12:20729144-20729166 ATGAAAGAGAAGCCTGGGGAGGG + Intronic
1093779762 12:23121736-23121758 ACGGAGAAGAGGACAGGGGCAGG + Intergenic
1094282111 12:28751832-28751854 ATGGAGAAGAAAAGAAGGGAAGG - Intergenic
1095870213 12:47018532-47018554 ATGGAGGAAAAGTCAGGTGATGG - Intergenic
1095945984 12:47753631-47753653 AAGGAGGAGGAGCCAGGGAAGGG + Intronic
1096876327 12:54633086-54633108 TGGGAGAAGAAGCCAGTGGGAGG - Intronic
1096879185 12:54653690-54653712 ATGGAGAGGGAGGCATGGGATGG + Intergenic
1096997197 12:55846007-55846029 ATGGAGGAGAGGTGAGGGGAGGG + Intergenic
1097043343 12:56169662-56169684 AAGGAGAAGGAGCCAAAGGAAGG - Exonic
1098676760 12:73299461-73299483 AGGGAGGAGAAGGGAGGGGAGGG - Intergenic
1099201364 12:79681116-79681138 AAGGAGAAGAAGGGAGGGGAGGG + Intronic
1100001047 12:89835550-89835572 TTGAAGAAGGAGGCAGGGGATGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1101761585 12:107663105-107663127 ATGGAGAAGAGGCCTGGCCAAGG - Intergenic
1101885789 12:108660549-108660571 ATAGGGAAGAAGGCAGAGGAAGG - Intronic
1102624256 12:114221860-114221882 ATAGCCATGAAGCCAGGGGAAGG + Intergenic
1102740097 12:115199411-115199433 AAGGAGAGGAAGCCAGGTGATGG - Intergenic
1102845459 12:116176786-116176808 ATTGAGAAAAAGCAAGGGGGAGG + Intronic
1102913422 12:116736267-116736289 ATAGAGAGGAAGGCAGAGGACGG + Intronic
1103019475 12:117522396-117522418 ATGGAGAGAAGGCCAGGGGTGGG + Intronic
1103059496 12:117847410-117847432 CAAGAGAAGAAGCCAGAGGAGGG + Intronic
1104029071 12:125051017-125051039 AGGAAAAAGAAGCCAGAGGATGG + Intergenic
1104363756 12:128157709-128157731 CTGGAGTAGAAGCAAAGGGAAGG - Intergenic
1104743386 12:131194804-131194826 ATGATGCAGAAGCCATGGGAGGG + Intergenic
1104790947 12:131481877-131481899 ATGATGCAGAAGCCATGGGAGGG - Intergenic
1105320863 13:19320271-19320293 AGGCAGGAGAAGCCAGGTGAGGG + Intergenic
1105803113 13:23927674-23927696 ATGCAGAAGAATCCAAGTGATGG - Intergenic
1106210340 13:27637231-27637253 ATGGAGAAAAACCCAAGGCATGG - Intronic
1106379455 13:29222810-29222832 TTGGAGCAGATGCCAGGAGAGGG - Intronic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108596145 13:51951342-51951364 ATGGAGAAGCAGCTAAGGGAGGG + Intronic
1109552172 13:63917845-63917867 AGGGAAAAGAAGGGAGGGGAGGG - Intergenic
1110083597 13:71347881-71347903 ATGGAATAGGAGTCAGGGGAAGG - Intergenic
1112194407 13:97210987-97211009 AGGGAGAGGAAGGCAGGGGTTGG + Intergenic
1112354456 13:98662173-98662195 CTGGAGAAGAAGCCAGAGCGTGG + Intergenic
1112727921 13:102326642-102326664 AGGGAGGAGAAGGGAGGGGAAGG + Intronic
1112819133 13:103310496-103310518 AAGGATAAGAAACCAAGGGAGGG + Intergenic
1113851171 13:113419039-113419061 AAGGAGAAGAAGGAAGGGAAGGG - Intergenic
1114207957 14:20590816-20590838 ATGGGGGAGCAGCCAGGGGTTGG - Exonic
1114263983 14:21060416-21060438 ACTGGGAAGAAGCCAGGGGATGG - Intronic
1114999700 14:28406842-28406864 ATGAATGAGAAGCCAGGGAATGG + Intergenic
1115368431 14:32584636-32584658 ATGGAGTAGAGGCCAGGGAGGGG - Intronic
1115624278 14:35174362-35174384 ATGGAGAAAAAAATAGGGGAGGG - Intronic
1115713062 14:36071870-36071892 ATGGATCAGAAGCTAGGGGCTGG - Intergenic
1115724189 14:36194740-36194762 AGGGAGAGGAAGGAAGGGGAGGG + Intergenic
1115835805 14:37400638-37400660 ATAGAGAAGAAGCAATGGAATGG + Intronic
1116531359 14:45977464-45977486 CTGGGGAAGAAGCCTGGGGAAGG + Intergenic
1116969788 14:51052007-51052029 AGGGAGAGGAAGGGAGGGGAGGG + Intronic
1117255748 14:53975754-53975776 ATGAAAAAGAGGCCAGAGGAGGG - Intergenic
1117375277 14:55113501-55113523 GGGAAGGAGAAGCCAGGGGAAGG - Intergenic
1117488877 14:56226259-56226281 ATGGAGAAGCAGCCTGGGCCTGG - Intronic
1117640654 14:57795617-57795639 ATGGACTAGAAGCCAGTAGATGG + Intronic
1117950058 14:61073859-61073881 GCTGAGAAGAAGGCAGGGGAGGG - Intronic
1119344669 14:73913439-73913461 ATGCTTAAGAAGCCAGGGAAAGG - Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120242138 14:81961820-81961842 CAGGAGAAGAAGCCAGGAGGTGG - Intergenic
1120603063 14:86536678-86536700 ATGGAGAAGTCGCCATGAGAAGG + Intergenic
1120751159 14:88199504-88199526 CTGGAAAAGCAGCCAGGGCAAGG + Intronic
1120779100 14:88469822-88469844 GTGGAGAAAAAGGCAGGGTAGGG - Intronic
1121115903 14:91342559-91342581 ATGAAGGAGAAGCCCGGGGTGGG - Intronic
1121419076 14:93799586-93799608 AGGGAGAAGAAGCCAGGGCAGGG - Intergenic
1121432969 14:93900371-93900393 AAGGAGATGGAGTCAGGGGAGGG - Intergenic
1121586230 14:95064810-95064832 AGAGAGAAGAAGGGAGGGGAGGG + Intergenic
1121704716 14:95982911-95982933 AAGGAGAAGGAGCTAGGGGCAGG - Intergenic
1122207754 14:100156678-100156700 ATGGAGGGGAACCCAGAGGAGGG + Intronic
1122270127 14:100565255-100565277 GTGGACAAGAAGGCAGGGAAGGG + Intronic
1122576638 14:102747165-102747187 ATGGAGGAGAGGGGAGGGGAGGG - Intergenic
1122662164 14:103303720-103303742 AAGAAGAAGCAGCTAGGGGAAGG + Intergenic
1122801273 14:104230824-104230846 ATGGAGATGAGGCCTGAGGAGGG + Intergenic
1122983194 14:105200691-105200713 ATGGAGAAGGGCCCAGAGGATGG - Intergenic
1123004881 14:105316351-105316373 ATGGAGAAGCAGCCAGGCCTGGG - Intronic
1123826904 15:24091687-24091709 ATTTAGAAGAGGCCAGGGGCAGG - Intergenic
1124457459 15:29857520-29857542 ATGGACAAGAAGCGCAGGGAAGG + Intronic
1125718659 15:41834712-41834734 AGAAAGAAGAAGACAGGGGATGG - Intronic
1126484975 15:49170137-49170159 AGGGAGGAGGAGCCAGAGGAGGG + Exonic
1126930852 15:53649338-53649360 ATTTAGAATAAGCCAGGGGTTGG - Intronic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127262151 15:57334469-57334491 GTGGAGGGGAAGCCAGGAGAGGG + Intergenic
1128223233 15:65983074-65983096 AGGGAGATGGAGCCAGGGGAGGG - Intronic
1128286219 15:66439115-66439137 ATCCAGAGGAAGCCAGGGCAGGG - Intronic
1128576154 15:68776648-68776670 ATGGTGCAGAAGCCCAGGGATGG + Intergenic
1128749812 15:70140800-70140822 CTGGAGAAGAAGGCAGGGCAGGG + Intergenic
1129326605 15:74803221-74803243 ATGGACAAGATGGCATGGGAGGG - Intergenic
1129964309 15:79720211-79720233 CTGGAGAAGAAACCTAGGGAAGG + Intergenic
1130040239 15:80400375-80400397 ATAGAGAAGAAGGCAGGGGTGGG + Intronic
1130573977 15:85074149-85074171 ATGCAGAATAGGCCAGGGGTAGG - Intronic
1130616464 15:85413503-85413525 ATGGAGTTGAAGTCAGGTGAAGG + Intronic
1131111037 15:89765654-89765676 AGGGAGAAGAGGGGAGGGGAGGG + Intronic
1131670015 15:94609764-94609786 ATGGAGATGAAGTTATGGGAAGG + Intergenic
1131670524 15:94614974-94614996 CTGGACAAGAAGAAAGGGGAGGG - Intergenic
1131802396 15:96084539-96084561 ATGGAGAAGAAGCCCAGAGCAGG + Intergenic
1131824173 15:96304179-96304201 CTGAAGCTGAAGCCAGGGGAGGG + Intergenic
1131957130 15:97748568-97748590 ATCGAGAAGAAGCCAGGTAATGG - Intergenic
1132082552 15:98879448-98879470 ATGGAGAATAAAACAGTGGAAGG - Intronic
1132143420 15:99412859-99412881 TTGGGGAAGAACCCCGGGGAAGG + Intergenic
1132199358 15:99938607-99938629 ATGGATAAGAATCCAGTGTAGGG + Intergenic
1132511737 16:346079-346101 CTGGAGAACAAGCCAGGGAAAGG - Intronic
1132644256 16:991579-991601 AGGGAGAAGAGGCGAGGAGAGGG + Intergenic
1132862252 16:2077523-2077545 GGGGAGAACAAGCCAGTGGAGGG - Intronic
1132916052 16:2345008-2345030 ATGGAGAGGAAATCAGGGAAGGG - Intergenic
1132983197 16:2749712-2749734 AGGGAAAAGAGGCCACGGGAAGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133510720 16:6454784-6454806 AATGGGAAGAAGCAAGGGGAGGG - Intronic
1133517599 16:6524813-6524835 ACAGAGAAGGAGCCAGGTGATGG - Intronic
1133588011 16:7214472-7214494 ATGGAGATGGAGGCAGTGGATGG - Intronic
1133931775 16:10238651-10238673 CTGGAAGAGAAGCCAGAGGATGG - Intergenic
1134031432 16:10995541-10995563 ATGGAAGAGAGGGCAGGGGAGGG - Intronic
1134613426 16:15629621-15629643 ATGGAGAAGGAGCCATGGTGTGG - Intronic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135066537 16:19314898-19314920 AGGGAGAAGAAGGGAGAGGAAGG + Intronic
1135978116 16:27124552-27124574 CTGGAGAGGAAGCCTGGGAAGGG - Intergenic
1136360409 16:29775818-29775840 TTGGAGAAAAAGAGAGGGGAAGG + Intergenic
1137617015 16:49854696-49854718 GGGGAGAGGAGGCCAGGGGAGGG + Intronic
1137832623 16:51558376-51558398 GTGGAGGAGAAGGGAGGGGAGGG + Intergenic
1138000647 16:53275599-53275621 ATGGAGAAGAAAACTGGGAAAGG - Intronic
1138033358 16:53578845-53578867 CTGGAGAAGAAGCATGGGAAGGG - Intergenic
1138404514 16:56778944-56778966 GAGGAGAAGAAGCCAGGAGGAGG + Intronic
1138539532 16:57679944-57679966 GGGGAGAGGAAGGCAGGGGAGGG - Intronic
1139004300 16:62551640-62551662 GGGGAGAAGAAGGGAGGGGAGGG - Intergenic
1139532968 16:67552483-67552505 ATGGAACAGAAGCCTGAGGAGGG + Intergenic
1139709032 16:68762082-68762104 ATGGAGCAGAAGCCCAGGGGAGG - Intronic
1139749980 16:69103936-69103958 ATGGAGAAGAAGCCTTAGGTTGG - Intergenic
1139785298 16:69387465-69387487 ATGGAAAAGCAGCCATGGGCCGG - Intronic
1140332719 16:74073324-74073346 ATGGAGGGGAAGAGAGGGGAAGG - Intergenic
1140781857 16:78304139-78304161 CGGGAGAAGAGGCCACGGGAAGG - Intronic
1142207513 16:88791180-88791202 ATGGAGGGGAAGAGAGGGGAGGG + Intergenic
1142529648 17:571230-571252 AGGGAGAGGAAGGGAGGGGAGGG + Intronic
1142774652 17:2127225-2127247 AAGTAGAAGTTGCCAGGGGAAGG + Intronic
1142862886 17:2774168-2774190 ATGGAGTAGAAGCTTGGGTATGG + Intergenic
1142887354 17:2921033-2921055 CGGGAGAAGAAGCCAGCGGGAGG - Intronic
1143373782 17:6455693-6455715 AGGGGGAAGAAGGGAGGGGAGGG + Intronic
1143864259 17:9912439-9912461 ATGGACAAGAAGGCTGGGGCTGG - Intronic
1143900336 17:10169699-10169721 ATGGAGAAGAGGTCTGGGGATGG - Intronic
1144291859 17:13834307-13834329 AGGGAGAAGAAGGTAGGGAAAGG - Intergenic
1145278997 17:21454988-21455010 AAGGAGAAGAGGGGAGGGGAGGG - Intergenic
1145901383 17:28492589-28492611 CTGGAGAAGTAGGCAGGGGAAGG + Intronic
1145935636 17:28713097-28713119 AGGGAGGGGAAGCCAGGAGAAGG + Intergenic
1146543199 17:33715711-33715733 ATGGAAAAGATGCCATTGGAAGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146577940 17:34011479-34011501 GTTGAGAAGAAGCCATGGGAGGG - Intronic
1146620037 17:34390138-34390160 ATGGAGTAGGAACCAGGGAAGGG - Intergenic
1147242776 17:39101484-39101506 ACGGAGAAGAAGGGAAGGGAGGG + Intronic
1147305671 17:39562485-39562507 ATAGAGAAGCAGCCAAGGAAAGG - Intronic
1147727802 17:42577564-42577586 ACGGAGAGAAAGGCAGGGGAGGG + Intronic
1147790960 17:43014085-43014107 CTGGAAAAGGAGCCAGGAGATGG - Intronic
1147877554 17:43632355-43632377 GTGGAGCAGATGCCAGGGGTGGG - Intergenic
1147982383 17:44282528-44282550 AAGGAGGAGAAGCCAGGGCCAGG - Intergenic
1148078711 17:44955530-44955552 ATGCAGAAGGAACCAGGGCATGG + Intergenic
1148190440 17:45675006-45675028 CTGGGGAGGAAGGCAGGGGAAGG - Intergenic
1148231908 17:45941467-45941489 CTGGGGTAGAAGCCAGGGGCAGG - Intronic
1148322119 17:46763540-46763562 TTGGAGAGGAAGCAAAGGGATGG + Exonic
1148330957 17:46813717-46813739 GGGGATAAGGAGCCAGGGGATGG - Intronic
1148480898 17:47958804-47958826 AAGGGCAAGAAGGCAGGGGATGG + Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148695545 17:49556083-49556105 GTGTTGAAGAAGCCAGGAGAGGG - Intergenic
1149768515 17:59300850-59300872 AGGGAGAGGAAGGTAGGGGAGGG - Intergenic
1151386837 17:73760206-73760228 GTGGAGGTGAAGCCAGGGGCAGG + Intergenic
1151656482 17:75498619-75498641 ATGGAAATGAAGACTGGGGAAGG - Exonic
1151680314 17:75619565-75619587 GGGGAGCAGACGCCAGGGGAAGG + Intergenic
1152032774 17:77854296-77854318 CTGCAGCAGAGGCCAGGGGAGGG - Intergenic
1152798451 17:82320207-82320229 ATGGAGCAAAGGCCAGAGGAGGG - Intergenic
1152802974 17:82340255-82340277 CTGGGGAAGAACACAGGGGAGGG - Intergenic
1152840664 17:82566044-82566066 ATGGAGAGGTGGCCAGGGGCTGG + Intronic
1152990831 18:362325-362347 ATTAAAAAGAAGTCAGGGGAGGG - Intronic
1153528159 18:6016915-6016937 ATGGAGAAGCAGCCAGGCCAGGG + Intronic
1153950494 18:10054126-10054148 ATGGAGGAGCAGGTAGGGGAGGG + Intergenic
1154021360 18:10666658-10666680 ACGGAGAAGCAGCCACAGGAAGG + Intronic
1154074722 18:11188862-11188884 TTGGAGAAGAAGCCAGGAACAGG - Intergenic
1155357850 18:24970739-24970761 ATGGGGAGGAAGGCATGGGAAGG + Intergenic
1155724285 18:29060228-29060250 ATGGAGAAGAAACTTGGAGAAGG + Intergenic
1155853938 18:30808613-30808635 AGGGAGAAGAAGCAAAGGGTGGG + Intergenic
1156309603 18:35909757-35909779 GGGGAGAGGAAGGCAGGGGAGGG + Intergenic
1156339202 18:36196105-36196127 AGGGAGAAGAAGCCAGTGCAGGG + Intronic
1156531069 18:37815614-37815636 ATAGAGGAGAAGCGAAGGGATGG + Intergenic
1156828517 18:41462990-41463012 ATGCAGAAGAAACCAGGTGAGGG - Intergenic
1157081053 18:44525580-44525602 ATGGAGCAGAAGCAAAGAGAAGG + Intergenic
1157300768 18:46477506-46477528 CTGGACAAGAAGCGGGGGGATGG - Intronic
1157301482 18:46482913-46482935 GCTGAGAAGGAGCCAGGGGAGGG - Intronic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157414882 18:47493931-47493953 AAGGAGAAAAAGCCAGCGTAAGG - Intergenic
1157621592 18:49020380-49020402 GTGGAGAAGAAGGCCGGGGGTGG - Intergenic
1157678420 18:49584575-49584597 ATGGAGAAAATGCCAGAGGAGGG - Intronic
1158146473 18:54319725-54319747 ATGGAGATGATGACAGGGCAAGG + Intronic
1158186713 18:54779913-54779935 AGGGAGAAGCAGTCAGGAGACGG - Intronic
1158186740 18:54780015-54780037 ATGGGGAAGCAGTCAGGAGAAGG - Intronic
1158247559 18:55449079-55449101 ATGGAGATGTGGCCAGGAGAGGG - Intronic
1158559917 18:58505149-58505171 GTGGAGAATAGGCCAGGGGCAGG + Intronic
1158692875 18:59676980-59677002 GTGGAGAGGAAGACAGGGGCCGG + Intronic
1159025685 18:63180531-63180553 ATGGAGATTAAGCCTGGGGTGGG - Intronic
1159503003 18:69298097-69298119 ATGGAGAAGGGGCGAGGGAAAGG - Intergenic
1159517671 18:69478395-69478417 AAGGAGGAGAAGGAAGGGGAGGG - Intronic
1160200454 18:76791591-76791613 ATGCTTAAGAAGCCAGGGAAAGG - Intergenic
1160327503 18:77964638-77964660 ATGGCTCAGGAGCCAGGGGAGGG - Intergenic
1160827056 19:1085492-1085514 ATGGAGGAGAGACAAGGGGAGGG - Intronic
1160827079 19:1085594-1085616 ATGGAGGAGAGACAAGGGGAGGG - Intronic
1161370539 19:3908653-3908675 AAGGAGGAGAAGAAAGGGGAAGG - Intronic
1161500814 19:4614436-4614458 ATGGAGATGAGGACAGGGGGTGG + Intergenic
1161834797 19:6638560-6638582 ATGGAGAAGAAAGCGTGGGAGGG + Intergenic
1162535501 19:11261357-11261379 AGGGACAAGAAGACAGGGAAGGG - Intronic
1162818806 19:13210743-13210765 ATGGAGAAGAAGCCAAGGAGGGG + Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163260805 19:16188759-16188781 AGGGAGAATCAGCCAGGTGAGGG + Intronic
1163507777 19:17718518-17718540 AGGGAGAGGAAGGGAGGGGAGGG + Intergenic
1163598438 19:18233717-18233739 ATGGTGCTGAAGGCAGGGGAGGG + Intronic
1163638826 19:18450368-18450390 AAGCTGTAGAAGCCAGGGGAGGG - Intronic
1163662580 19:18587657-18587679 ATGGACAAAAAGAAAGGGGAGGG + Intronic
1163762700 19:19146065-19146087 AAGGGAAGGAAGCCAGGGGATGG + Intronic
1165087220 19:33359021-33359043 ATAGTGAGGAAGCCAGGGGCAGG - Intergenic
1165148709 19:33748883-33748905 TTGGAGGAGAAGGCAGGTGAAGG + Intronic
1165434183 19:35787647-35787669 GGGGAGAAGAAGCCGGGGGTAGG - Exonic
1165844993 19:38812520-38812542 CTGGAGAAGAGGCCTGGTGAGGG + Intronic
1165863284 19:38920277-38920299 AGGGAGAAGAAGACACGGAAAGG + Intronic
1166056510 19:40292826-40292848 ATTGAGAAGATTCCTGGGGAGGG - Intergenic
1166057907 19:40304396-40304418 ATTGAGAAGATTCCTGGGGAGGG - Intergenic
1166063700 19:40343774-40343796 ATTGAGCAGAAGCCAGAGAAGGG - Intronic
1166331029 19:42078104-42078126 AAGGAGCAGAGGCCATGGGAGGG + Intronic
1166947073 19:46404016-46404038 CGGGAGAGGAAGCCAGAGGAAGG - Intergenic
1167070906 19:47221573-47221595 CTGGCCAAGAAGCCAGGAGAGGG - Exonic
1167270183 19:48501965-48501987 AGGGAAGAGGAGCCAGGGGAGGG - Intronic
1167270214 19:48502057-48502079 GGGGAGGAGGAGCCAGGGGAGGG - Intronic
1167520691 19:49952731-49952753 ATGCTTAAGAAGCCAGGGAAAGG - Intronic
1167698281 19:51027398-51027420 AGGGAGAAGCGGGCAGGGGAAGG - Intronic
1167987151 19:53328154-53328176 ATAGGGAATAAGGCAGGGGAGGG + Intergenic
1168115120 19:54218055-54218077 ATGAAGAGGAGCCCAGGGGACGG + Intronic
925791866 2:7497382-7497404 ATAGCAAAGAAGCCCGGGGAGGG + Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
926052711 2:9755018-9755040 ATGGAAACGGAGCAAGGGGAGGG + Intergenic
926647988 2:15310732-15310754 AGGCAGAAGGAGCCAGGAGAAGG - Intronic
927088168 2:19690508-19690530 AGGGAGCAGAAGGGAGGGGAGGG + Intergenic
927943964 2:27123664-27123686 GAGGGGAAGAAGGCAGGGGAGGG + Intergenic
928600422 2:32898985-32899007 ATGGGGGAGAAGCAAGAGGAGGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
930571092 2:53088153-53088175 GTGGAGGAGAAGTAAGGGGAGGG + Intergenic
930725334 2:54676146-54676168 ATGGAGATGAGGCAGGGGGAAGG - Intergenic
930741254 2:54835035-54835057 AGGGAGAAGCAGCGAGGGGAAGG - Intronic
931270710 2:60699985-60700007 CTGAAGAAGAATCCAGGGGAAGG - Intergenic
931465369 2:62482028-62482050 CTGAAGAAGGATCCAGGGGAAGG + Intergenic
931638723 2:64362966-64362988 ATGAGGAAGAAGGCAGGAGACGG - Intergenic
932476687 2:72011008-72011030 TTGTGCAAGAAGCCAGGGGAGGG + Intergenic
932494816 2:72141060-72141082 ATGGAGAAGGAGCTAGAGAATGG - Intronic
932628982 2:73322221-73322243 AGTGAAAAGAAGCCAGGGCAGGG - Intergenic
932692959 2:73929108-73929130 AAGGAGGGGAAGCGAGGGGAGGG - Intronic
933274292 2:80267155-80267177 AGGGAGAGGAAGCCATCGGAAGG - Intronic
933462025 2:82600496-82600518 AGGGAGTAGAACTCAGGGGAGGG + Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
935535355 2:104286957-104286979 ATCCAGAAGATGCAAGGGGAGGG + Intergenic
935787974 2:106566425-106566447 AAGGTGAAGAAGAGAGGGGAAGG + Intergenic
935941639 2:108245081-108245103 ATGGAGAAGAAAACAGTAGAGGG + Intergenic
935958172 2:108399242-108399264 ATGGGGAGGTAGCAAGGGGATGG - Intergenic
936268893 2:111033181-111033203 ATGGAGGAGGAGCGAGGAGAGGG + Intronic
936524407 2:113233052-113233074 GTGGAGAGGAAGGGAGGGGAAGG - Intronic
936747659 2:115598367-115598389 ATTAAGAAGAAGGCAGGGAAGGG - Intronic
937148906 2:119672395-119672417 AGGCAGAAGGAGCCAGGGGAAGG + Intergenic
937711044 2:124980202-124980224 TTGGTGAAGATGCCACGGGAAGG - Intergenic
937971436 2:127552325-127552347 ATGGAAATGAAGCCAGGAGGTGG + Intronic
938379888 2:130830636-130830658 ATGGAGTAGAAGCTAGGGTGGGG - Intergenic
939078437 2:137630425-137630447 ATGGGGAAGAAGTTTGGGGATGG - Intronic
939882244 2:147643589-147643611 AAGGACAGGAGGCCAGGGGAGGG - Intergenic
939915446 2:148036587-148036609 ATGGAGAAAAAGCCAGTTGATGG - Intronic
940004992 2:149002040-149002062 ATGGAGGAGGAGCCTGTGGAGGG + Intronic
940020350 2:149149790-149149812 ATGGAGATAAAGAAAGGGGAAGG - Intronic
940539135 2:154988401-154988423 ATGGTGAAAAACCCAGGAGAAGG + Intergenic
940911181 2:159211461-159211483 AAGGAAAAGAGGGCAGGGGAGGG - Intronic
940986502 2:160057035-160057057 ATGGCCAATTAGCCAGGGGAAGG + Intronic
941364669 2:164595533-164595555 ATGAAACAGAGGCCAGGGGAAGG + Intronic
942946709 2:181681178-181681200 AAGGAGAAGAAGCCAAGGGATGG - Intergenic
943958269 2:194222248-194222270 ATGGGTAATAAGCCAGTGGAAGG + Intergenic
944189124 2:196982552-196982574 TTGGGGAAGAAGCCAGGGCTGGG - Intronic
945346635 2:208725561-208725583 AAGGAAAAGTAGTCAGGGGAAGG + Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946764154 2:223024504-223024526 AGGGAGATGAAGCCAAGGCAGGG + Intergenic
947712520 2:232324137-232324159 ATGGAGAAGAGGCCATGGTTGGG + Intronic
947984536 2:234437310-234437332 AGGGAGAAGAGGCCAGGGTGAGG - Intergenic
948174126 2:235929672-235929694 ATGGATGAGAAGCCAGAGGCAGG - Intronic
1168947169 20:1770740-1770762 GTGGAGAAGAGGGCAGGGTAAGG + Intergenic
1169044995 20:2528097-2528119 ATGGAGCAGAAGAAAGGGGCAGG + Intergenic
1169264198 20:4157731-4157753 ATGGACATGAAGCTGGGGGAGGG + Intronic
1169284654 20:4297840-4297862 AAGGAGAAAAAGTCAGGAGAGGG - Intergenic
1169950735 20:11040549-11040571 AAGGAGAAGGCTCCAGGGGAAGG + Intergenic
1170085850 20:12530899-12530921 AAGGAGAAGAAGCCAAGCAAGGG + Intergenic
1170141733 20:13131741-13131763 ATGGAGAAGAAGCCATAAAAAGG - Intronic
1170442364 20:16391700-16391722 CAGGAGAAGAAACCAAGGGAGGG + Intronic
1170874065 20:20234438-20234460 ATGGAGAAGAAGCAAGGGTTAGG + Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171266082 20:23773240-23773262 AGAGGGAAGAAGCCAGGGCAGGG + Intergenic
1172483455 20:35285072-35285094 ATGGAAATGAAGCCGGAGGAAGG + Intergenic
1172692933 20:36803085-36803107 ATGGAGCTGAAGACAGGGAAGGG - Exonic
1173350704 20:42242834-42242856 ATGGAGAAGAAGCCATTGAAGGG + Intronic
1173530850 20:43768328-43768350 AGGGAAAAGGAGCCAGGGGGTGG + Intergenic
1173706358 20:45113278-45113300 AAGGTGACGAAGCCAAGGGAAGG - Intronic
1174818622 20:53708734-53708756 AAAGAAAAGAAGACAGGGGAGGG - Intergenic
1175170219 20:57074920-57074942 ATGCAGAAGAGACCTGGGGACGG + Intergenic
1175629241 20:60519312-60519334 ATGGAGAAGAAGTCAGTAAAAGG - Intergenic
1175912681 20:62412304-62412326 TGAGAGAAGGAGCCAGGGGATGG - Intronic
1175928353 20:62481618-62481640 ATGGTGAAGAAGCCAAGGCCAGG + Intergenic
1176756678 21:10730838-10730860 ATGGAGAGGAATGGAGGGGAGGG - Intergenic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1178887676 21:36496656-36496678 ATGGAGAAGAAAGCAGAGGAAGG + Intronic
1179113763 21:38470907-38470929 CTGGACCAGGAGCCAGGGGAGGG + Intronic
1179343963 21:40538780-40538802 ATGGAGCACAAGGGAGGGGAAGG + Intronic
1179766064 21:43574000-43574022 ATGGAGCAGAAGCCCGTCGATGG - Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180208714 21:46280089-46280111 AAGGAGAAGAAACCAGGTGACGG - Exonic
1180638586 22:17280065-17280087 ATGGAGAAGGACCCAGGAAATGG + Intergenic
1180786309 22:18549691-18549713 ATGAGGAAGAAGGGAGGGGATGG - Intergenic
1180951168 22:19721281-19721303 ATGGAGACCATGCCAGGGGCAGG + Intronic
1181131590 22:20735417-20735439 ATGAGGAAGAAGGGAGGGGATGG - Intronic
1181243230 22:21489244-21489266 ATGAGGAAGAAGGGAGGGGATGG - Intergenic
1181600043 22:23945741-23945763 ATGTAGAAAAGGCCAAGGGAAGG + Intergenic
1181608459 22:23995582-23995604 ATGTAGAAAAGGCCAAGGGAAGG - Intergenic
1181639497 22:24189244-24189266 ATGGAGAGAGAGCCTGGGGAGGG - Intergenic
1182181695 22:28356295-28356317 ATAGAGGAGAATCCAGTGGATGG - Intronic
1182185597 22:28398344-28398366 ATGGAGAGGGAGCCAGAAGAGGG + Intronic
1182426200 22:30274236-30274258 TTGGGGAAGGAGCCAGGAGAGGG + Intergenic
1182686515 22:32124322-32124344 ATGGAGGCATAGCCAGGGGAAGG + Intergenic
1182715179 22:32352580-32352602 GTGGAGGTGCAGCCAGGGGAAGG - Intergenic
1182943169 22:34297672-34297694 AAGGAGAGCAGGCCAGGGGAGGG - Intergenic
1183656612 22:39189359-39189381 TTGGAGGAGAAGGCAGGGTACGG + Intergenic
1184658280 22:45952948-45952970 AAGGGGCAGCAGCCAGGGGAGGG - Intronic
1184856314 22:47148635-47148657 CAGGAGAGGAACCCAGGGGAGGG - Intronic
1184856360 22:47148745-47148767 CAGGAGAAGAACCCAGAGGAGGG - Intronic
1184891921 22:47385058-47385080 GTGGAGAAGAAGCAAGGGTGTGG + Intergenic
1184909019 22:47513618-47513640 ATGGAGATGAAGGCAGAGGCTGG - Intergenic
1185036953 22:48484480-48484502 AAGGAGAAGGAGGGAGGGGAGGG - Intergenic
1185330489 22:50250028-50250050 ACGGAGGAGCAGCCAGGGGAAGG + Intronic
950257460 3:11517577-11517599 ATCCAGAAGAAGCCAGAGGAGGG + Intronic
950260224 3:11537986-11538008 ATGTAGAAGAGGCCAGGGAAAGG + Intronic
950610209 3:14121981-14122003 GTGGAGAAGACGGAAGGGGAGGG + Exonic
950857766 3:16121374-16121396 AGGGAGAGGAAACCAGGGAAAGG + Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951391832 3:22114547-22114569 AATGAAAAGAAGCCAGTGGAAGG + Intronic
951569187 3:24044307-24044329 AGTGGGCAGAAGCCAGGGGAGGG + Intergenic
952041692 3:29268790-29268812 AGAGGGAAGAAGCCAGAGGAAGG + Intergenic
952125413 3:30294198-30294220 AGGGAGAGTAAGCCAGGTGAAGG - Intergenic
952552047 3:34490075-34490097 AAGTAGAATAAGGCAGGGGAAGG + Intergenic
952556931 3:34542278-34542300 ATGGGCCAGAAGCCAGGAGATGG + Intergenic
952995873 3:38881779-38881801 ATGCAGAGGGTGCCAGGGGAAGG - Intronic
953347228 3:42186269-42186291 AGGGAGAAGAGGCCAGGCGCAGG - Intronic
953465567 3:43116400-43116422 ATAGAGCAAAGGCCAGGGGAAGG + Intergenic
953715971 3:45317350-45317372 ATGGCAAAGAAGCCATAGGATGG - Intergenic
953975226 3:47377180-47377202 CGGGAGTAGAGGCCAGGGGAAGG + Intergenic
954722680 3:52578941-52578963 CTGGAGAAACTGCCAGGGGAAGG + Intronic
955019541 3:55105979-55106001 ATGGAGAGTCAGCCTGGGGAGGG + Intergenic
955768361 3:62367936-62367958 AGGAAGACGCAGCCAGGGGAGGG - Intergenic
956289394 3:67646078-67646100 ATGGAGGGGAGGGCAGGGGAGGG + Intronic
956849650 3:73217364-73217386 ATGGAGGATAAGCTAGGAGAGGG + Intergenic
957199673 3:77116497-77116519 ATGGAGAAGGAGCCAAGGAAGGG - Intronic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957843955 3:85706438-85706460 AAGGAGAGGAAGCCAAGGGGCGG - Intronic
961172695 3:124809442-124809464 CTGGAGAAGCAAGCAGGGGATGG - Intronic
961377921 3:126479191-126479213 ATTTTGGAGAAGCCAGGGGAAGG + Intergenic
961471163 3:127113882-127113904 ATCTGGAAGCAGCCAGGGGAGGG + Intergenic
961684593 3:128620832-128620854 ATGGAGATGAGGCCCAGGGATGG - Intronic
961781004 3:129320016-129320038 ATGGGGAGGAAGCCATGGGTTGG - Intergenic
962264934 3:133938049-133938071 ATGGAAAGGAAGCCAGGGCTGGG + Intronic
962646935 3:137449417-137449439 AAGGAAATGTAGCCAGGGGAAGG + Intergenic
962713447 3:138107001-138107023 TTGGAGAAGATGCAAGGGGAAGG + Intronic
964183075 3:153911311-153911333 ATGCAGCAAAAGCCAGGGCATGG + Intergenic
964538560 3:157753907-157753929 GTGCAGAGTAAGCCAGGGGATGG + Intergenic
964990307 3:162802601-162802623 ATAGAGAAGAGGCAAGTGGATGG + Intergenic
965560535 3:170058086-170058108 ATGAAGTAGAAGCAAGGGGGAGG + Intronic
966427245 3:179792551-179792573 CTGGAGTGGAAGCCAGGAGAAGG + Intergenic
967053970 3:185811792-185811814 ATGGAGCACATGGCAGGGGACGG + Intronic
967069765 3:185952534-185952556 TTGGAGAAGAAGCCAGCTGCTGG + Intergenic
967217396 3:187222073-187222095 GGGGAGAGGAAGCCAGGGCAGGG + Intronic
968427994 4:535765-535787 GTGGAGCAGAAGCCAGAGGGCGG - Intronic
968467184 4:758581-758603 ATGGAGAAGAACTCGGGGGAGGG - Intronic
969828868 4:9779918-9779940 CAGGAGAAGAAGATAGGGGAAGG + Intronic
970148943 4:13068856-13068878 CTGCAGAAGGAGCCAGGAGATGG + Intergenic
970309550 4:14767833-14767855 GGGGAGGAGAAGCCAGGGTAGGG + Intergenic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
970450177 4:16158447-16158469 ATGGATAAGAAGGGAGAGGAAGG - Intergenic
970590848 4:17559609-17559631 ATGGTGGAGTAGACAGGGGAGGG - Intergenic
971419783 4:26464859-26464881 TTGGAGAAGAAGGGAGGTGACGG - Intergenic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
972866631 4:43241263-43241285 ATGCAGAAGCAGCCAGATGATGG - Intergenic
973608107 4:52607760-52607782 CTGGAACAGAAGCCAGGGGTTGG - Intronic
973972449 4:56226903-56226925 AAGGAGAAGAAGCCACAGGGAGG - Intronic
974228122 4:59075247-59075269 AAGGAGAAGAAGGAAGGGAAGGG + Intergenic
975171204 4:71233765-71233787 ATATTGAAGGAGCCAGGGGAAGG - Intronic
975707044 4:77121776-77121798 CTGGACAAGAACCCAGGGCAGGG - Intergenic
975746539 4:77480757-77480779 ATGGAGAAGAGGCCACTGAAGGG - Intergenic
976113936 4:81706387-81706409 AAAGAAAAAAAGCCAGGGGAAGG - Intronic
976523455 4:86058236-86058258 AAGGAGAAGTAACCAGGGAACGG - Intronic
976569781 4:86594618-86594640 CTGTAGAAGGAGCCTGGGGAGGG - Exonic
976607808 4:86998907-86998929 GTGGAGAACAAGCCAGGAAAAGG + Intronic
976957680 4:90922299-90922321 AAGGAGAAGAGGGAAGGGGAAGG + Intronic
977092181 4:92691451-92691473 AAGGAGCAAAAGCCATGGGATGG + Intronic
978023273 4:103840261-103840283 CTGGAAAAGAATCCAAGGGAAGG - Intergenic
978157788 4:105509378-105509400 AAGGAGAGGAAGACAGGGAAAGG + Intergenic
978407533 4:108395890-108395912 AAGGAGAAAAAGCCATGGGCTGG - Intergenic
979491071 4:121328458-121328480 AGGGAGAAGCAGCCAAGTGACGG - Intergenic
980134581 4:128847246-128847268 ATGGCGGAGAAGCCAGGTGCCGG - Intronic
980563027 4:134502041-134502063 AGGGGGAGGAAGGCAGGGGAGGG - Intergenic
980888964 4:138793783-138793805 AAGGAGAAGAGGGGAGGGGAAGG + Intergenic
980905463 4:138944425-138944447 ATGAGGAGGAAGCCAGGGAAAGG - Intergenic
982122365 4:152155499-152155521 ATGGACAAGAAGCCCAGGGATGG - Intergenic
983952526 4:173659396-173659418 ATGGAAAAGAAGTGAGGGGTGGG + Intergenic
984628951 4:182040011-182040033 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984628982 4:182040086-182040108 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984629022 4:182040186-182040208 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984629033 4:182040211-182040233 GGGGAGAAGAGGGCAGGGGAGGG + Intergenic
984911203 4:184676295-184676317 AGGGAGGGGAAGGCAGGGGAGGG - Intronic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985898255 5:2763542-2763564 CTGGAGAGGAGGCCAGGAGAGGG - Intergenic
986425528 5:7627381-7627403 ATGGAGAAGAAGCCATAGAGGGG + Intronic
986606186 5:9525504-9525526 AGGGACAAGGACCCAGGGGATGG + Intronic
986609254 5:9550483-9550505 ATGGAGATGAAGCCTCTGGATGG + Intergenic
987047921 5:14124834-14124856 ATGGAGAAGGAGGCCGGGCATGG + Intergenic
988671266 5:33384648-33384670 CTGGAGAAGAAGCAAGGCGGGGG + Intergenic
989122895 5:38021760-38021782 ATAGAGGAGAAGGAAGGGGAAGG - Intergenic
989962249 5:50430178-50430200 ATGGACAGGAAGCCAGGCGGGGG + Intronic
990061743 5:51658708-51658730 AGGCAGAAGAGCCCAGGGGAAGG + Intergenic
990255816 5:53967755-53967777 AGCGATCAGAAGCCAGGGGATGG + Intronic
990507059 5:56455503-56455525 ATGGACAGGAAGCCTGGAGATGG - Intergenic
991156177 5:63439101-63439123 ATGGAGAAGAGACAAAGGGAGGG - Intergenic
991365722 5:65866067-65866089 ATGGGGAAGAAGACAGAAGAGGG + Intronic
991540310 5:67720479-67720501 AGGGAGAAGAGGAGAGGGGAGGG - Intergenic
992396485 5:76373623-76373645 ATGGAGAAAAAGCCAGGTAGAGG + Intergenic
994070729 5:95599009-95599031 AAGAAGAAGAAGGCAGGGTAAGG - Intronic
994154412 5:96486775-96486797 ATGGAGAAGAATCAAGGAGCAGG - Intergenic
994223800 5:97228633-97228655 ATGGAGGAGAGGACAGGAGAGGG + Intergenic
995379533 5:111517050-111517072 AAGGAGAAGAAGGCAGGATATGG - Intergenic
995675913 5:114662239-114662261 AAGGAGTAGAAGCCAGAGGTTGG + Intergenic
996519736 5:124413561-124413583 ATGGAGAAGAAGGCAGGGAGAGG + Intergenic
996925924 5:128826555-128826577 ATAGTTAAGAAGACAGGGGAAGG + Intronic
997427592 5:133814506-133814528 ATGGAGAAAAACACAAGGGATGG + Intergenic
998011620 5:138699803-138699825 TGGGTGAAGAAGCCAGGGCAGGG + Intronic
998637451 5:143971755-143971777 ATGGATAAGAAGCCATTGGAGGG + Intergenic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999615085 5:153414520-153414542 ATGGGGCAGAACCCAGGGGAAGG - Intergenic
1001044666 5:168362751-168362773 ATGGAGGTGAAGGAAGGGGATGG + Intronic
1001413856 5:171529350-171529372 ATGAGGAGGAAGCCAGAGGAAGG - Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001933885 5:175691255-175691277 CTGGAGAGGAAGTCAGGGGAAGG + Intergenic
1002473243 5:179450086-179450108 AGGCAGAAGGAGCAAGGGGAGGG + Intergenic
1002480978 5:179500567-179500589 AGGCAGAAGGAGCAAGGGGAGGG - Intergenic
1002740722 5:181433432-181433454 AGGAAGAAGAAGCCAGGGCCTGG + Intergenic
1002792784 6:447889-447911 AGGGAGAACGAGCCAGAGGAAGG + Intergenic
1002802028 6:533014-533036 AAGGAGAAGTACCCAGTGGAAGG + Intronic
1002886078 6:1295499-1295521 AGGGAGAGGAAGGCAGGGGAGGG - Intergenic
1003482387 6:6545917-6545939 CTGGAGAAGGAGCTTGGGGATGG - Intergenic
1003619461 6:7685188-7685210 CTGGAGAAGAAGCCTTGGGATGG + Intergenic
1003777888 6:9389888-9389910 ATGAAAAAGGAGGCAGGGGATGG + Intergenic
1004136074 6:12968097-12968119 AGGGAAAAGAACCCAAGGGAAGG + Intronic
1004165484 6:13253097-13253119 GTGGGGAAGAAGCCAGGAGACGG - Intronic
1004681104 6:17895546-17895568 ATTGAGATGCAGCCAGGGGTAGG - Intronic
1004695242 6:18027164-18027186 ACTGAGAAGAAGCCTGGGCATGG + Intergenic
1004945608 6:20609348-20609370 AAGGAGAAGAAGGGAGGAGAAGG - Intronic
1005736510 6:28752848-28752870 ATGCTTAAGAAGCCAGGGAAAGG + Intergenic
1005939869 6:30552959-30552981 ATGTGCAAGAGGCCAGGGGAAGG - Intronic
1006096762 6:31660975-31660997 GTGGAAAAGAACCCAGGGGCAGG - Intergenic
1006278707 6:33029016-33029038 ATGGAGAAGGAGAGAGGGGGAGG - Intergenic
1006334392 6:33412937-33412959 AGGGAGAAGCAGCCATGGAAAGG + Intronic
1006495087 6:34417049-34417071 ATGGAGAAGAAGCACAGGAATGG - Intronic
1006677390 6:35774209-35774231 CTGGAGAGGAGGCCTGGGGATGG - Intergenic
1007177887 6:39909125-39909147 AGGGAGAGGAAAGCAGGGGAGGG + Intronic
1007177897 6:39909152-39909174 AGGGAGAGGAAAGCAGGGGAGGG + Intronic
1007177906 6:39909179-39909201 AGGGAGAGGAAAGCAGGGGAAGG + Intronic
1007177916 6:39909206-39909228 AGGGAGAGGAAAGCAGGGGAGGG + Intronic
1007177929 6:39909238-39909260 AGGGAGAGGAAAGCAGGGGAGGG + Intronic
1007177943 6:39909271-39909293 AGGGAGAGGAAAGCAGGGGAGGG + Intronic
1007177956 6:39909304-39909326 AGGGAGAGGAAAGCAGGGGAAGG + Intronic
1007694659 6:43724677-43724699 AAGGAGCAGGAGGCAGGGGATGG - Intergenic
1007763970 6:44150325-44150347 ATGGGGCAGGAGCCAGGGTAGGG + Intronic
1008345145 6:50417385-50417407 AAACAGAAGAATCCAGGGGATGG + Intergenic
1009051891 6:58285443-58285465 AAAGAGAAGAAGCAAGAGGAAGG - Intergenic
1010918436 6:81650033-81650055 ATGGACAAGAAGCCATTAGAGGG - Intronic
1012334156 6:98032951-98032973 ATGGACAAAAAGCCAGAGGTGGG + Intergenic
1012476987 6:99624518-99624540 ATGGAGATGAACACAGAGGAAGG + Intergenic
1015209587 6:130682190-130682212 ATGAAGAAAGGGCCAGGGGAGGG - Intergenic
1015631878 6:135239327-135239349 ATGGGGAAGAAGCCAAGCAAGGG + Intergenic
1015685040 6:135850157-135850179 ATGCAGATGAAGCCATGGAAAGG - Intergenic
1015786553 6:136924445-136924467 ATGGAGGAGCTGCCCGGGGAGGG + Exonic
1016291580 6:142534066-142534088 TTGGAGAAGTGGCAAGGGGAAGG - Intergenic
1016528907 6:145036630-145036652 ATGGAGGAGGAGCCACAGGACGG - Intergenic
1017867585 6:158457328-158457350 ATGCAGAAGAGGCCTGGGCAGGG - Intronic
1018066688 6:160129402-160129424 ATGCACCAAAAGCCAGGGGAGGG - Intronic
1018641487 6:165908182-165908204 ATGGAAATGAAGCCACAGGAAGG + Intronic
1018747431 6:166773228-166773250 TTGGAGAAGGAGGCAGGGAAGGG + Intronic
1018929618 6:168232320-168232342 AAGGAGAGGAAGACAGGGCATGG - Intergenic
1018948517 6:168363737-168363759 CTGGAGATGAAGCCAGGTGTGGG + Intergenic
1018986382 6:168640346-168640368 ATGGAGAGGAAGCATGGGGCAGG + Intronic
1019245831 6:170709028-170709050 AGGAAGAAGAAGCCAGGGCCTGG + Intergenic
1019344371 7:522231-522253 ATGGAAACGAAGGCCGGGGAGGG - Intergenic
1019359552 7:597710-597732 CTGGCGATGAAGCCGGGGGAAGG + Intronic
1019366323 7:635274-635296 ATGTGGAAGCTGCCAGGGGAGGG - Intronic
1019416957 7:932256-932278 CTGGAGAGGAAGGCTGGGGAGGG - Intronic
1019535328 7:1526293-1526315 AAGGAGAAGAGGGGAGGGGAGGG + Intergenic
1019878137 7:3834102-3834124 ATGTAGAAGAACCAAGGGAAGGG + Intronic
1020442607 7:8234341-8234363 ATGTGGACGAAGCAAGGGGAGGG - Intronic
1021142563 7:17045485-17045507 ATGGAGAAGAAGCCAAAGAGAGG - Intergenic
1021329656 7:19320171-19320193 ATGGCGAAATAGCCAGGGAATGG + Intergenic
1021439187 7:20659001-20659023 ATGTAGAAGAAGCAAAGGGTGGG - Intronic
1021540369 7:21750761-21750783 ATGGAGAAGAATTCAAGGGGAGG + Intronic
1022277031 7:28865430-28865452 AAGGAGTAGATGCCAGGGTAAGG + Intergenic
1022590210 7:31654341-31654363 ATGGAGATGGAGGGAGGGGAAGG + Intronic
1022822818 7:33977972-33977994 ATGAAGAAGCAGCCAGTTGAGGG + Intronic
1023300886 7:38769825-38769847 ATGGAGATGGGGCCAGAGGAGGG - Intronic
1023347596 7:39287349-39287371 AGGGAGAAGAATCCAGGGGAGGG - Intronic
1023909417 7:44542651-44542673 ATGGGGAATGAGCCAGGGGATGG + Intergenic
1024171405 7:46791300-46791322 ATGGAGGGGCAGCAAGGGGAAGG + Intergenic
1024554956 7:50595518-50595540 GAGGAGAAAAAGCCTGGGGAAGG + Exonic
1024644043 7:51356484-51356506 ATGGAGACAAAGCCAGAGCAGGG - Intergenic
1025247013 7:57325165-57325187 AGGGAGCAGGAGCCATGGGAGGG + Intergenic
1026877338 7:73887148-73887170 AGGGAGATGAAACCAGGGGAAGG - Intergenic
1027271211 7:76520075-76520097 AAGAAGAAGAACCCAAGGGAGGG + Intergenic
1027684057 7:81259376-81259398 AGAGAGAAGAAACCAGGAGAGGG + Intergenic
1028833337 7:95348563-95348585 ATAAAGAAGAAACCAGTGGATGG + Intergenic
1029304898 7:99611868-99611890 ATAGAGATGAAGCCAGTGGAGGG - Intergenic
1029578360 7:101419099-101419121 AGGGAGAAGAGGGGAGGGGAGGG - Intronic
1029646605 7:101860788-101860810 AGAGAGAAGAAGAGAGGGGAAGG - Intronic
1029706289 7:102278073-102278095 CTGGAGCTGAGGCCAGGGGAGGG - Intronic
1029732005 7:102444648-102444670 AAAAAGAAGAAGCCTGGGGAAGG - Intronic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031642810 7:124186225-124186247 CTGGAGAAGGAGCCAATGGAGGG + Intergenic
1032199299 7:129808127-129808149 ATAGAGAAGAGGGAAGGGGAGGG - Intergenic
1032392371 7:131563891-131563913 ATGGAGATGAAACTGGGGGAGGG + Intergenic
1033519830 7:142149354-142149376 AAAGAGAAGAGGCCAGAGGATGG - Intronic
1033982615 7:147184725-147184747 AAGGAGAAGAAAGAAGGGGATGG + Intronic
1034298573 7:149995396-149995418 AGGGAGAGGAGGACAGGGGAAGG + Intergenic
1034411709 7:150945552-150945574 ATGGAGGAGGAGGAAGGGGAGGG + Intronic
1034464380 7:151217926-151217948 GTGGAGCAGCAGCCAGGAGAGGG - Intronic
1034467560 7:151238851-151238873 AAGGAGAAGAATCCAAGGGAAGG + Intronic
1034807441 7:154101382-154101404 AGGGAGAGGAGGACAGGGGAAGG - Intronic
1034859875 7:154585946-154585968 AAGGAGAGGAAGGCAGGGGAAGG + Intronic
1035009883 7:155705603-155705625 CTGGGGAAGAAGGCAGGAGAAGG + Intronic
1035020502 7:155797460-155797482 CTGGAGAAGCAGCCAGGAGCTGG + Intergenic
1035044152 7:155953026-155953048 CTGGTGCAGAAGGCAGGGGAGGG + Intergenic
1035502292 8:99170-99192 AGGAAGAAGAAGCCAGGGCCTGG - Intergenic
1035783670 8:2247411-2247433 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783683 8:2247449-2247471 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783696 8:2247487-2247509 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783707 8:2247525-2247547 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783733 8:2247601-2247623 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783746 8:2247639-2247661 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783771 8:2247715-2247737 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783823 8:2247867-2247889 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783836 8:2247905-2247927 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783849 8:2247943-2247965 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783887 8:2248056-2248078 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783900 8:2248094-2248116 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783913 8:2248132-2248154 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783973 8:2248322-2248344 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783997 8:2248398-2248420 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784019 8:2248474-2248496 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784055 8:2248588-2248610 CTGTAGGAGGAGCCAGGGGAAGG + Intergenic
1035784081 8:2248664-2248686 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784202 8:2249044-2249066 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784215 8:2249082-2249104 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784265 8:2249234-2249256 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784290 8:2249310-2249332 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784474 8:2249918-2249940 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035808335 8:2471795-2471817 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808369 8:2471909-2471931 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808382 8:2471947-2471969 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808395 8:2471985-2472007 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808418 8:2472061-2472083 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808444 8:2472137-2472159 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808457 8:2472175-2472197 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1036177176 8:6550170-6550192 ATGGAGCCGACGCCAGGCGAGGG - Intronic
1036408536 8:8477500-8477522 AAGGAGAAGAAGGCAGGGCCAGG + Intergenic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037218216 8:16484057-16484079 AAGGAGAAGAAGAAAGGGTAGGG + Intronic
1037510799 8:19579906-19579928 ATGAAGAAGAAGGAAGGGAAAGG + Intronic
1037809814 8:22080729-22080751 AAGAAGAAGAAGCCGGGGTAAGG + Intronic
1037898916 8:22676178-22676200 TTGAAGAAGACCCCAGGGGAGGG - Intergenic
1038053773 8:23838341-23838363 ATGTAGAAGAATCAAGGGAATGG + Intergenic
1038487677 8:27948441-27948463 ATGGAAGAGAAGATAGGGGAAGG - Intronic
1039354762 8:36802721-36802743 AGGGGGAAAATGCCAGGGGAAGG - Intronic
1039445993 8:37632795-37632817 CTGGAGAAGAGACCAGGGGTTGG + Intergenic
1039475482 8:37837379-37837401 AGGGAACAGAAGCCAGGCGAAGG - Intronic
1039740607 8:40379438-40379460 AAGGGAAAGAAGCCAGGGGCAGG - Intergenic
1041628146 8:60054949-60054971 TTGGAGATGAAGGGAGGGGAGGG + Intergenic
1041831509 8:62160324-62160346 ATGGTGGAGAAACCTGGGGAAGG + Intergenic
1042130477 8:65582724-65582746 AAGGAGAAGGAGGCAGGGGAAGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042734217 8:71969530-71969552 CTGGAGAACAAGCCAGGAAAGGG - Intronic
1043059523 8:75482358-75482380 ATGGAGCAGAAGGGAGGGGAGGG - Intronic
1043117125 8:76271596-76271618 ATGTTTAAGAAGCCAGGGAAAGG + Intergenic
1043300581 8:78726060-78726082 ATGGAGAAAAAGCATGGGGGTGG + Intronic
1043384451 8:79734180-79734202 GAGGTGAAGAAGCCAGTGGAGGG + Intergenic
1043515194 8:80989609-80989631 ATGAGGAAGAAGGCAGGGGATGG + Intronic
1043835398 8:85039535-85039557 ATGAACAAGAAGCCAGGATAAGG - Intergenic
1044113814 8:88309390-88309412 ATGGGAAGGAAGGCAGGGGAAGG + Intronic
1044458690 8:92419055-92419077 ATGGAGAAGAAAGAAAGGGAAGG + Intergenic
1045150246 8:99398285-99398307 AAGGAGAAGGAGCCAATGGAGGG + Intronic
1045242789 8:100416958-100416980 CTTGGCAAGAAGCCAGGGGAGGG + Intergenic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1047190063 8:122670387-122670409 AAGGAAAAGAAGCAAGAGGAAGG + Intergenic
1047455359 8:125003938-125003960 TTGGAAAAAAAGACAGGGGAGGG - Intronic
1047467286 8:125129243-125129265 ATTGAGAAGGAGCCACTGGAGGG + Intronic
1047898067 8:129388879-129388901 AAGAAAAAGAAGCCACGGGAAGG + Intergenic
1048031123 8:130633446-130633468 GAGGAGAAGAAGGAAGGGGAGGG - Intergenic
1048118609 8:131553802-131553824 ATGAAGAAGAAGGCAGTGGCTGG + Intergenic
1048249108 8:132844147-132844169 TTGGAGAAGAATCCAGCTGAAGG + Exonic
1048470223 8:134698360-134698382 AAGGAGAAGGAGGCAAGGGAAGG + Intronic
1048502860 8:134994503-134994525 AAGGAGAAGATGCCTGTGGAAGG + Intergenic
1048636554 8:136302024-136302046 GTGGTGAAGAAAGCAGGGGACGG - Intergenic
1048948334 8:139471552-139471574 ATGGAGTAGAAGAAAGGGGGAGG + Intergenic
1049493890 8:142919997-142920019 ATGAAAAAGAAACCAGGGGTTGG - Intergenic
1049575536 8:143388150-143388172 AGGGAGTAGAAGCCAGTGGTGGG + Intergenic
1049919039 9:346269-346291 ATGGAAAATAAGCCAGGAGTTGG - Intronic
1050530014 9:6580568-6580590 AGGGATCAGAAGGCAGGGGAAGG - Intronic
1050555721 9:6788182-6788204 ATGAAGAAGAACCAAGGGTAAGG - Intronic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052864554 9:33457092-33457114 CAGGGGAAGAATCCAGGGGAGGG + Intergenic
1053432575 9:38052794-38052816 ATGGAGGAGAAGCCAGGTGTGGG - Intronic
1055561555 9:77526555-77526577 ACAGGGAAGAAGCCAGGCGAAGG + Intronic
1056266485 9:84901760-84901782 ATGGAGAAGAAGCCAGGGGAGGG - Intronic
1056887538 9:90457709-90457731 CTGGAGAAGAAGGCATGGGCTGG - Intergenic
1056928519 9:90854951-90854973 AGGGGGAAGAAGTGAGGGGATGG - Intronic
1056939912 9:90946182-90946204 ATTGAGAAGAGGGCAGGGGAAGG + Intergenic
1057226652 9:93296425-93296447 ATGGAGAAGGAGGAAGGTGAGGG - Intronic
1057371899 9:94480687-94480709 GTGGAGGAGCAGCCAGGGTAAGG + Intergenic
1057423079 9:94927675-94927697 CTGGGGCAGCAGCCAGGGGAGGG - Intronic
1057717272 9:97504471-97504493 AGTGAGAAGAACCCAGGAGAGGG + Intronic
1057810486 9:98253444-98253466 ATAGAGAAGAAACTAGGGGAAGG - Intronic
1058358680 9:104115282-104115304 ATGTACAAGAAGCCTGGGTATGG + Intronic
1058817573 9:108699061-108699083 ATGGAGGGGAAGGGAGGGGAAGG + Intergenic
1059351814 9:113670811-113670833 ATGGACAACAAGCCAGGGTCTGG - Intergenic
1059424403 9:114211609-114211631 ATGGAGAAAGAGCCAAGGCACGG + Intronic
1059707200 9:116836352-116836374 ATGCTGAATAGGCCAGGGGATGG + Intronic
1060031178 9:120216334-120216356 ATGGTGAAGAAGGCAGAGAATGG + Intergenic
1060041266 9:120303749-120303771 ATGGAGAGAAAGCCAGTGGAAGG + Intergenic
1060070686 9:120544474-120544496 CTGGAGAAGAAGCCTGGGCCTGG + Intronic
1060257014 9:122040105-122040127 AGGGATAAAAAGCCAGGGCAGGG + Intronic
1060725384 9:126002674-126002696 ATGGGGAGGAGGCCAGGGGAGGG + Intergenic
1061026850 9:128055349-128055371 AGGGAGAAGAAGGGAGGGGAAGG + Intergenic
1061144699 9:128790842-128790864 AGGAGGAAGAAGCCAGGGGTAGG - Intronic
1061214480 9:129213195-129213217 CTGGAGAAGAGGTCAAGGGAGGG - Intergenic
1061450451 9:130664533-130664555 ATGGAGAAGGAACCAGAGCAGGG - Intergenic
1061498247 9:130987908-130987930 ATGGAGCAGAGCCCAGGGGAGGG + Intergenic
1061587524 9:131578528-131578550 AGGGAGGGAAAGCCAGGGGATGG + Exonic
1061594509 9:131620207-131620229 ATGGAGAAGATGCCCAAGGATGG + Intronic
1061614922 9:131773324-131773346 AGGCAGAGGGAGCCAGGGGAAGG - Intergenic
1061671069 9:132188453-132188475 TGGGATAAGAAGCCAGGGGATGG - Intronic
1061847851 9:133397945-133397967 AGGGACAGGAAGGCAGGGGAGGG - Intronic
1061926916 9:133810424-133810446 AGGAAGAAGAAGCCAGAGGATGG - Intronic
1062192932 9:135257026-135257048 AGGGAGAGGAAGGGAGGGGAGGG - Intergenic
1062564527 9:137158269-137158291 AGGGAGAAGGAGCAGGGGGAAGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062597670 9:137306435-137306457 GAGGAGGAGAAGCCCGGGGAGGG - Intergenic
1203490610 Un_GL000224v1:101543-101565 ATGCTTAAGAAGCCAGGGAAAGG - Intergenic
1203503233 Un_KI270741v1:43422-43444 ATGCTTAAGAAGCCAGGGAAAGG - Intergenic
1203606030 Un_KI270748v1:58239-58261 AGGAAGAAGAAGCCAGGGCCTGG + Intergenic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1185630855 X:1514867-1514889 GGGGAGAGGAAGACAGGGGAAGG - Intronic
1185641132 X:1589158-1589180 ATGGAGGGGAAGGGAGGGGAAGG - Intergenic
1185641164 X:1589228-1589250 ATGGAGGGGAAGGGAGGGGAAGG - Intergenic
1185739848 X:2523033-2523055 ATGGGAAAGAGGCCGGGGGAAGG + Intergenic
1186495240 X:10007738-10007760 ATGGAGAAGAAGCCAGCTGCAGG - Intergenic
1186788259 X:12973412-12973434 TGGGAGAAGAAGCCAGGAGAAGG + Intergenic
1187592777 X:20736596-20736618 ATGAAGTGGAAGCCAAGGGAGGG + Intergenic
1187730885 X:22253143-22253165 ATCTATAAGAAGCCAGTGGAGGG + Intergenic
1187882873 X:23862844-23862866 AGGGAGAAGGAGGGAGGGGAGGG + Intronic
1187969676 X:24647206-24647228 GGGGAGAAGAAGCGGGGGGATGG - Exonic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188914724 X:35896443-35896465 ATGGTGGAGAAGCCATTGGATGG - Intergenic
1189214494 X:39311417-39311439 AGAGAGAAGAACACAGGGGACGG + Intergenic
1189508677 X:41638809-41638831 TAGGAGAGGAAGCCAGTGGAGGG + Intronic
1189645115 X:43119924-43119946 ATGGACAAAAAGCAAGGGGATGG - Intergenic
1189877761 X:45454485-45454507 GCGGAGGAGAAGGCAGGGGAGGG + Intergenic
1190171006 X:48111633-48111655 ATGGAGAAGGAGCAGGGGCAGGG + Intergenic
1191183737 X:57588317-57588339 TTGGAGAAGAACCCACTGGATGG - Intergenic
1192175293 X:68881242-68881264 ATGGAGAACAGGCTGGGGGAGGG + Intergenic
1192322099 X:70098227-70098249 ACAGATAGGAAGCCAGGGGAGGG + Intergenic
1193117017 X:77785580-77785602 GTGGGGAAGAAGCGGGGGGAGGG - Intronic
1193363450 X:80602497-80602519 ATTGAGCAGAAGCCAGGTGAAGG - Intergenic
1193979893 X:88169144-88169166 CTGGAGAAGCAGTTAGGGGAGGG + Intergenic
1195116743 X:101706961-101706983 ATAGAGTAGTAGCCAGGGGCGGG + Intergenic
1196050096 X:111295865-111295887 ATGGAGAAGAAGAAAGGGCCAGG + Exonic
1196058055 X:111377423-111377445 ACAGAAAAGAAGCCAGGAGAAGG + Intronic
1196413087 X:115440524-115440546 TTGGGGAAGAAGCCATGGAAAGG + Intergenic
1196992075 X:121341057-121341079 ATGAAGGAGAAGCCATGGAATGG - Intergenic
1198672085 X:139091869-139091891 ATGGACAAGAAGCTAGGGAGGGG + Intronic
1199706066 X:150426472-150426494 ATGGAGAAGAAGCAATCGGAAGG - Intronic
1199907737 X:152251565-152251587 ATGGAAGAGAAGCAAGAGGAAGG - Intronic
1199997492 X:153035035-153035057 ATGCTTAAGAAGCCAGGGAAAGG + Intergenic
1200081396 X:153578545-153578567 AAGGTGGAGAAGCCAGAGGAGGG + Intronic
1200232311 X:154450146-154450168 ATGGAGGAGAAGCCAAGGGAAGG + Intronic
1201146286 Y:11067095-11067117 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146388 Y:11067409-11067431 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201935875 Y:19410663-19410685 ATTATTAAGAAGCCAGGGGAGGG + Intergenic
1202076966 Y:21045792-21045814 ATTTAGAAGAAGCAAGGGAAAGG + Intergenic