ID: 1056267896

View in Genome Browser
Species Human (GRCh38)
Location 9:84917803-84917825
Sequence CTGGCGCCTGACTGTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056267896 Original CRISPR CTGGCGCCTGACTGTTTTGT TGG (reversed) Intronic
906462155 1:46042998-46043020 CTGGCAACAAACTGTTTTGTTGG + Exonic
907240833 1:53080167-53080189 CTGGGGCCTGGCTGTTGTGCTGG + Intronic
907556542 1:55349127-55349149 GTGGGGCCTGACTCTTCTGTTGG - Intergenic
908062880 1:60371011-60371033 CTGGCAACTGATTGTTTTCTGGG - Intergenic
908711446 1:67019996-67020018 CTGAGGTCTGGCTGTTTTGTAGG - Intronic
913167692 1:116203633-116203655 CTGGCGGCCGTCTGTTTTATGGG - Intergenic
920969446 1:210730606-210730628 CTGGAGTCTTACTATTTTGTGGG + Intronic
923104379 1:230843263-230843285 CTGTGGCCTGCCTGCTTTGTGGG + Intronic
923239737 1:232071582-232071604 CTGGTCCTGGACTGTTTTGTTGG + Intergenic
924718452 1:246601006-246601028 CTGGCGTCTCATTGTTTGGTGGG - Intronic
1063823496 10:9865766-9865788 ATGGAGGCTGACTGTATTGTTGG - Intergenic
1065923765 10:30417487-30417509 CTGCTGCCAGACTGTCTTGTGGG + Intergenic
1068788826 10:61005507-61005529 CTGGTCCTGGACTGTTTTGTTGG + Intergenic
1071836338 10:89421821-89421843 CTTGGGCCTGCCTGTGTTGTAGG - Intergenic
1075809180 10:125211982-125212004 GTGGCGCATGAATTTTTTGTTGG + Intergenic
1077781149 11:5330993-5331015 ATGGCCCATGACTGTTTTATTGG - Intronic
1080465008 11:32488279-32488301 CTGGCCCCAGCCTGTTTTGCAGG + Intergenic
1086962369 11:92991584-92991606 CTGGCCCTTGACTGTTATCTGGG - Intergenic
1087479456 11:98680833-98680855 CTGGGGCATGTCTGTTCTGTAGG - Intergenic
1088219885 11:107558589-107558611 ATGCCGTCTGAGTGTTTTGTGGG + Intronic
1090193396 11:124793516-124793538 GTGGCTAGTGACTGTTTTGTTGG - Intronic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1096192187 12:49626997-49627019 GTGGCCCCCTACTGTTTTGTAGG + Intronic
1105898851 13:24740258-24740280 CTCGCTCCTGTCTGTTGTGTGGG + Intergenic
1111897788 13:94162492-94162514 CTGGGGCTTGAGTGTGTTGTTGG + Intronic
1113706105 13:112433930-112433952 CTGGGACCTGACTGTTCTGCAGG + Intronic
1114393872 14:22339048-22339070 CTGGCTTCTGGGTGTTTTGTTGG - Intergenic
1115171143 14:30508173-30508195 CTGGTATCTGAGTGTTTTGTTGG + Intergenic
1118098820 14:62571603-62571625 CTAGTGCCTGACTGTAATGTGGG - Intergenic
1121891646 14:97598962-97598984 CTGGGCCTGGACTGTTTTGTAGG - Intergenic
1121902685 14:97708379-97708401 CTGTCCCCTGGCTGTTTTATTGG + Intergenic
1125386856 15:39146954-39146976 CTGACCCCTAACAGTTTTGTGGG + Intergenic
1131833061 15:96366437-96366459 CTGGACCCTGACTTTTTTGGAGG - Intergenic
1132604134 16:786629-786651 CTGGCTCCTGACTGATTCCTTGG - Intronic
1141611259 16:85182322-85182344 CTGGAGCCTGCCTGGTTTCTTGG - Intronic
1145998763 17:29119093-29119115 CTGGGGCCTGGCTGTATTGGAGG - Intronic
1149047143 17:52259897-52259919 CTAGATACTGACTGTTTTGTAGG + Intergenic
1162396304 19:10419710-10419732 CTGTCGTCTGACTGTAGTGTCGG - Intronic
1162931051 19:13958008-13958030 CTGGCCCCTGGCTTATTTGTGGG - Intronic
1164682621 19:30145754-30145776 TTGGCGCCGGACTTTTCTGTGGG + Intergenic
924974161 2:157652-157674 CTGTCACCTGACTCTTTTGAAGG - Intergenic
927014785 2:18947842-18947864 TTGGCGGCTGAATATTTTGTAGG - Intergenic
927241462 2:20923153-20923175 ATGGAGACTGACTGTCTTGTTGG + Intergenic
931308515 2:61056143-61056165 CTGGGGGCTCTCTGTTTTGTTGG + Intergenic
933175278 2:79166846-79166868 CTGTCACCTGACTCTTTTGAAGG - Intergenic
945688976 2:213008817-213008839 ATGGCACCTCACTGTTGTGTAGG + Intronic
947828708 2:233124284-233124306 CTGGCTCCTGCCTGTTCTGGGGG + Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1170395452 20:15921078-15921100 CTCTCACCTGGCTGTTTTGTGGG - Intronic
1170407133 20:16050200-16050222 CTGGCCCCTGTCTGCTTTCTTGG + Exonic
951035795 3:17930601-17930623 CTGGCTGCTGACTGTTGGGTGGG + Intronic
952754088 3:36850954-36850976 CTGGCTGCTGACTGTACTGTGGG - Intronic
960981533 3:123232548-123232570 CTGGCCCTTTACTGTTTTTTTGG - Intronic
962607575 3:137045258-137045280 CTGGAGTCTTGCTGTTTTGTGGG + Intergenic
965985260 3:174745456-174745478 CTGGCCCCAGACTTTTTGGTTGG - Intronic
967997801 3:195179973-195179995 CTGGAGCCTGCCTGTGTTGGGGG - Intronic
969613470 4:8239659-8239681 CTGGCTCCTTCCTGTTTAGTTGG + Intronic
973001119 4:44952024-44952046 GTGGCACATGACTGTTTTCTAGG + Intergenic
987962249 5:24824871-24824893 CTGGGGCTTCACTGTTTTATTGG + Intergenic
990092106 5:52064412-52064434 CTGGGGTATGTCTGTTTTGTGGG + Intronic
995782711 5:115795139-115795161 CTGGCACATGTCTTTTTTGTGGG - Intergenic
996356222 5:122599201-122599223 ATGGAGCCTTACTGTTTTCTGGG + Intergenic
1002439329 5:179256211-179256233 CTGGCGGCTTACTGTTCTGTGGG - Intronic
1006188986 6:32196280-32196302 CGTGCGCCTGACTGTTTTGTGGG + Intronic
1010994835 6:82521142-82521164 CTGGCTCCTGAATCCTTTGTTGG - Intergenic
1020244419 7:6419740-6419762 CTGGCCCCTGACGGGTTTCTGGG + Intronic
1022441003 7:30433303-30433325 TTGGAGCCTGGCTGTTTTCTGGG - Intronic
1022834967 7:34104646-34104668 CTAGAGTCAGACTGTTTTGTTGG - Intronic
1030050020 7:105529676-105529698 CTGGCCCCTAACTGTATTTTTGG - Intergenic
1037203803 8:16290192-16290214 CTGGAACTGGACTGTTTTGTAGG + Intronic
1038275622 8:26118405-26118427 CTGTCTCCTGCCTGTGTTGTGGG - Intergenic
1045189061 8:99865473-99865495 CTGGCGGAGGCCTGTTTTGTTGG - Intronic
1047836360 8:128697770-128697792 TTGGGGCCTGACTGTTTAATTGG - Intergenic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1193306698 X:79959419-79959441 CTGTCGCCTGACTCTATTGAAGG + Intergenic