ID: 1056268128 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:84920183-84920205 |
| Sequence | ATTCACATTCATAAGGTGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1056268124_1056268128 | 0 | Left | 1056268124 | 9:84920160-84920182 | CCTGTTCATTTCATTATAATTAC | 0: 1 1: 0 2: 1 3: 25 4: 338 |
||
| Right | 1056268128 | 9:84920183-84920205 | ATTCACATTCATAAGGTGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1056268128 | Original CRISPR | ATTCACATTCATAAGGTGGA GGG | Intronic | ||
| No off target data available for this crispr | |||||