ID: 1056268128

View in Genome Browser
Species Human (GRCh38)
Location 9:84920183-84920205
Sequence ATTCACATTCATAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056268124_1056268128 0 Left 1056268124 9:84920160-84920182 CCTGTTCATTTCATTATAATTAC 0: 1
1: 0
2: 1
3: 25
4: 338
Right 1056268128 9:84920183-84920205 ATTCACATTCATAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056268128 Original CRISPR ATTCACATTCATAAGGTGGA GGG Intronic
No off target data available for this crispr