ID: 1056271836

View in Genome Browser
Species Human (GRCh38)
Location 9:84954745-84954767
Sequence GTCCCCACCAGCACCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 271}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056271836_1056271841 3 Left 1056271836 9:84954745-84954767 CCAGCTCTGGTGCTGGTGGGGAC 0: 1
1: 0
2: 0
3: 31
4: 271
Right 1056271841 9:84954771-84954793 CTGGAGGAATCAGCTTGGTTGGG No data
1056271836_1056271844 14 Left 1056271836 9:84954745-84954767 CCAGCTCTGGTGCTGGTGGGGAC 0: 1
1: 0
2: 0
3: 31
4: 271
Right 1056271844 9:84954782-84954804 AGCTTGGTTGGGGGATACTCTGG No data
1056271836_1056271840 2 Left 1056271836 9:84954745-84954767 CCAGCTCTGGTGCTGGTGGGGAC 0: 1
1: 0
2: 0
3: 31
4: 271
Right 1056271840 9:84954770-84954792 TCTGGAGGAATCAGCTTGGTTGG No data
1056271836_1056271843 5 Left 1056271836 9:84954745-84954767 CCAGCTCTGGTGCTGGTGGGGAC 0: 1
1: 0
2: 0
3: 31
4: 271
Right 1056271843 9:84954773-84954795 GGAGGAATCAGCTTGGTTGGGGG No data
1056271836_1056271842 4 Left 1056271836 9:84954745-84954767 CCAGCTCTGGTGCTGGTGGGGAC 0: 1
1: 0
2: 0
3: 31
4: 271
Right 1056271842 9:84954772-84954794 TGGAGGAATCAGCTTGGTTGGGG No data
1056271836_1056271846 29 Left 1056271836 9:84954745-84954767 CCAGCTCTGGTGCTGGTGGGGAC 0: 1
1: 0
2: 0
3: 31
4: 271
Right 1056271846 9:84954797-84954819 TACTCTGGCATAGCCTGGCTAGG No data
1056271836_1056271845 24 Left 1056271836 9:84954745-84954767 CCAGCTCTGGTGCTGGTGGGGAC 0: 1
1: 0
2: 0
3: 31
4: 271
Right 1056271845 9:84954792-84954814 GGGGATACTCTGGCATAGCCTGG No data
1056271836_1056271839 -2 Left 1056271836 9:84954745-84954767 CCAGCTCTGGTGCTGGTGGGGAC 0: 1
1: 0
2: 0
3: 31
4: 271
Right 1056271839 9:84954766-84954788 ACACTCTGGAGGAATCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056271836 Original CRISPR GTCCCCACCAGCACCAGAGC TGG (reversed) Intronic
900112511 1:1014481-1014503 GCCTCCACCAGCATCCGAGCAGG + Exonic
900138297 1:1128065-1128087 GTCAGCACGAGCACCAGACCTGG - Intergenic
900141459 1:1140909-1140931 GTGCCCACCAGCCTCGGAGCCGG - Intergenic
900154158 1:1197421-1197443 TCCCCCACCCGCACCAGACCTGG + Exonic
900230863 1:1556641-1556663 GTGCCCAGCAGCTCCAGAGATGG - Intronic
900290024 1:1919849-1919871 GCCCAGACCAGCAGCAGAGCAGG - Intergenic
900576658 1:3385919-3385941 GTCCACACCACCACCAGAACAGG + Intronic
900647392 1:3715155-3715177 ATCCCCAGCAGGACCAGGGCAGG + Intronic
900763598 1:4488792-4488814 TTCCCCACCAGCTCCATGGCTGG - Intergenic
900988718 1:6087684-6087706 GTCCCCAGCAGGGGCAGAGCTGG + Intronic
901194449 1:7432631-7432653 GACCACCCCAGCACCAGAGGTGG - Intronic
901740143 1:11336298-11336320 GTCCTAGCCAGCACCAGAGTGGG + Intergenic
902380733 1:16051087-16051109 CCCCCCACCACCACCAGAGCTGG - Intronic
903741354 1:25560417-25560439 GTGCCCAGCAGCACCAGGGAGGG - Intronic
904860985 1:33537495-33537517 GAGCCCACCAGCACCAGAGGGGG + Exonic
905466148 1:38155176-38155198 GTCCTCACCAGCCCCACAGGTGG - Intergenic
905846890 1:41241581-41241603 GTCCCCTCCGGCGCCAGAGGTGG - Intronic
906247937 1:44290177-44290199 GTGCCCACCAGCTCCAGGACAGG + Intronic
907427992 1:54393207-54393229 ATCCTCACAAGCACCAGGGCTGG + Intronic
910647131 1:89525472-89525494 GTTCCCAACAGCGCCAGCGCAGG - Intronic
910896480 1:92075332-92075354 GTCTCCTCCAGTCCCAGAGCAGG + Exonic
912334535 1:108850009-108850031 GACAGCACCAGCAACAGAGCTGG - Intronic
913169906 1:116222412-116222434 GTAACCACCAGCACCAAAACTGG + Intergenic
915308339 1:154993816-154993838 CTCCCCACCAGCACCATGGCTGG + Exonic
916601775 1:166300001-166300023 ATCCCCACCACCATCATAGCAGG - Intergenic
919865814 1:201782242-201782264 GTCCCGACCAGCATCAGAGGAGG - Exonic
921050289 1:211506231-211506253 GTCCCCAAAGGCACCTGAGCTGG + Intergenic
922030344 1:221791461-221791483 GTCCCCACCAGCAATGGGGCTGG + Intergenic
922548551 1:226476628-226476650 GTCCTCACCACCATCAGAACAGG - Intergenic
923102276 1:230826177-230826199 GTGCCTGGCAGCACCAGAGCAGG - Intergenic
1064425198 10:15224031-15224053 GCCTCCACCAGCACCACTGCTGG - Intronic
1067208872 10:44242190-44242212 CTCCCCACCTGTACCAGGGCAGG - Intergenic
1067717902 10:48703952-48703974 GACCTCAGCAGCACCAGTGCTGG - Intronic
1069080461 10:64083320-64083342 TTCCCCACCAGCCCTAGTGCAGG + Intergenic
1069430737 10:68332174-68332196 GACCCCGCGAGCACCAGAGTCGG + Exonic
1069872198 10:71540047-71540069 GCCCCCACCAGCACACTAGCGGG - Intronic
1070394699 10:76002093-76002115 GTCTTCACCAGAAACAGAGCTGG - Intronic
1071087111 10:81876334-81876356 CACCCCCCCAGAACCAGAGCAGG - Intronic
1073242114 10:102065742-102065764 TCCCACACCAGCACCAGCGCCGG - Exonic
1075738107 10:124676580-124676602 GGCCCCACCAGCACAAAAGATGG + Intronic
1076176812 10:128374535-128374557 GTCCCCACCAGCCACTGGGCAGG - Intergenic
1076474356 10:130742161-130742183 TTCAGAACCAGCACCAGAGCAGG - Intergenic
1076575433 10:131463601-131463623 TTCCCCACCTTCACCAGAACCGG + Intergenic
1076707543 10:132309875-132309897 GTCCCCACCACCACCTAAGAGGG + Intronic
1077309930 11:1883784-1883806 CTCCCCACCAGCTCCAGAACTGG + Intronic
1078018973 11:7639879-7639901 GAGGCCACCAGCACCAGGGCTGG - Intronic
1078722339 11:13896692-13896714 CTGCCCTCCAGCACTAGAGCAGG - Intergenic
1083228955 11:61303012-61303034 CTCCCCACCACTCCCAGAGCTGG + Intronic
1084641874 11:70431011-70431033 GATCCCACCAGCACCCCAGCAGG - Intronic
1085741223 11:79079950-79079972 GGTCACACCAGCTCCAGAGCTGG + Intronic
1089086152 11:115818613-115818635 TTGCCCACCAGCAGCAGAGCTGG - Intergenic
1089088895 11:115849582-115849604 ATCCCCGCCATCTCCAGAGCAGG + Intergenic
1089318797 11:117611013-117611035 ATCCCCACCAGCAGCACAGGAGG + Intronic
1090042318 11:123301865-123301887 GTCCCCACCTGCCCAAGCGCCGG + Intergenic
1090923014 11:131223803-131223825 CTCCATCCCAGCACCAGAGCAGG + Intergenic
1091847148 12:3666072-3666094 CTCCTCCCCACCACCAGAGCAGG - Intronic
1094470362 12:30796537-30796559 GTCCCCACCAGAGCCGGGGCTGG - Intergenic
1096685525 12:53286046-53286068 GTGGCCACCAGCTCTAGAGCAGG - Exonic
1096797464 12:54086854-54086876 GCCTCCTCCAGCACCAGAGAGGG + Intergenic
1096987306 12:55768568-55768590 GTGCCCACCACCACCACACCAGG + Intronic
1098567605 12:71953413-71953435 ACCCCCACCAGCACCATGGCAGG - Intronic
1100481548 12:94984184-94984206 GTCCCCACCAGTACCACTGACGG - Intronic
1101297616 12:103440486-103440508 GTACCCACTTGCACCAGAGTAGG - Intronic
1101815012 12:108139429-108139451 CTCCCCACCTGAACCTGAGCTGG - Intronic
1102119540 12:110429618-110429640 GTCCCCACCACCAACGGAGTGGG + Intergenic
1102829478 12:115983460-115983482 GACCCCACCAGCAGCAGCACAGG - Exonic
1104566966 12:129893993-129894015 ATCCCCACCAGCATCAGATGAGG + Intronic
1104583306 12:130026912-130026934 GTTCCCCCCAGCTCCAGAGATGG - Intergenic
1104977515 12:132558857-132558879 GTCCCTGGCCGCACCAGAGCCGG + Intronic
1105722962 13:23134852-23134874 GTCCCCACCACCAAGAGAGTGGG - Intergenic
1106365963 13:29081211-29081233 TTTCCCACAAGCACCAGAGGAGG + Intronic
1106917096 13:34527566-34527588 TTACCCACCAGGACCAGGGCTGG + Intergenic
1110147059 13:72204504-72204526 TTCCCCACCAGCACACCAGCAGG - Intergenic
1111423743 13:88052257-88052279 GTGCCCCACAGCTCCAGAGCTGG + Intergenic
1113662026 13:112114323-112114345 CTCCCCACCTGCTCCAGTGCAGG - Intergenic
1113674903 13:112200427-112200449 GTGCCCACCAGAGCCAGGGCGGG + Intergenic
1113704148 13:112415086-112415108 TTCCCCAACTGCATCAGAGCTGG - Intronic
1114792316 14:25673451-25673473 GTCCCTACCAACTCCAGAGATGG - Intergenic
1121311101 14:92935545-92935567 GTCCCCAGCCACACCTGAGCTGG + Intergenic
1122072368 14:99213020-99213042 GTCTCCACCTTCACCTGAGCAGG + Intronic
1122353397 14:101110288-101110310 GTCCCCACCAGCACCTTCCCTGG - Intergenic
1122964824 14:105117969-105117991 CTCTCCAAGAGCACCAGAGCAGG - Intergenic
1123008426 14:105335511-105335533 GTCCCCACCTGCCCCAGAATAGG - Intronic
1123113907 14:105885258-105885280 GTCCTCAGCAGCATCACAGCGGG - Intergenic
1124658890 15:31529092-31529114 GTCCCCATCAGCACAACAGCGGG - Intronic
1125300793 15:38252347-38252369 GTGCCCACCAGCAGCTCAGCGGG - Exonic
1128075122 15:64821077-64821099 GCCCCCACCAGTCCAAGAGCTGG - Exonic
1128722069 15:69957449-69957471 GTCCATACCAGAACCTGAGCAGG + Intergenic
1128732812 15:70032766-70032788 GACCCCAACACCACCAGAGATGG + Intergenic
1128964258 15:72041733-72041755 GTCCCCTACAGCTGCAGAGCCGG + Intronic
1129250237 15:74304691-74304713 CTCCCCGCCAGCTCCAGGGCTGG - Intronic
1129266356 15:74395592-74395614 CTCCCCATCAGCGCCAGAGCAGG + Intergenic
1129698353 15:77753477-77753499 GTGCCCACCAGCCCCAGGGAGGG - Intronic
1129740099 15:77985966-77985988 GTCCCCACCAGGTCTAGATCGGG - Intronic
1130048782 15:80466242-80466264 GTCCCCATCAGGAACAGAGTTGG + Intronic
1130371154 15:83285679-83285701 ATCCCCACCAGCAGCAAGGCAGG - Intergenic
1131048051 15:89328666-89328688 GCCCCCTCCAGCACCATACCTGG + Exonic
1132715687 16:1288920-1288942 GTCCCCACCCACCCCAGGGCTGG + Intergenic
1132808389 16:1786343-1786365 GTCCCCTGCAGCCCCAGACCCGG - Intronic
1134241255 16:12508736-12508758 ATCTCCACCAGCTCCAGGGCGGG + Intronic
1134258520 16:12631076-12631098 GGCCCCACCAGCAGCAGCGCTGG - Intergenic
1134433519 16:14234269-14234291 GTACCCACCTTCACCAGTGCTGG - Exonic
1137351063 16:47714352-47714374 GTCCTCACCAGGATCAGGGCAGG - Intergenic
1137415364 16:48272763-48272785 GTCCCCAACAGCACAAGGGCAGG - Intronic
1138081440 16:54094714-54094736 CTCCCTCCCAGCCCCAGAGCTGG + Intronic
1138428120 16:56950177-56950199 GACCCCACAACCTCCAGAGCCGG - Intergenic
1143775418 17:9195794-9195816 CCCCCCTCCAGCCCCAGAGCAGG + Intronic
1143803881 17:9409084-9409106 GCCCCCGCCCCCACCAGAGCTGG + Intronic
1145981486 17:29014864-29014886 GTCTCCACCAGCAGCTGAGGTGG + Intronic
1147256615 17:39185640-39185662 GTAGACACCAACACCAGAGCAGG + Intronic
1147359246 17:39920955-39920977 TGCCCCACCAGCACCTCAGCGGG + Intergenic
1147459527 17:40559381-40559403 GTGGCTACCAGCACCAAAGCAGG - Intronic
1148204052 17:45768522-45768544 CTGCCCTCCAGCACCAGGGCAGG - Intergenic
1148446525 17:47741214-47741236 ATCTCCACCAGCACCAGCACGGG - Intronic
1151470317 17:74313959-74313981 GCCCTCACCAGCCGCAGAGCTGG + Intronic
1151519078 17:74615574-74615596 TTCCCCAGCAGCGCTAGAGCAGG + Intronic
1151682900 17:75631062-75631084 GTCCCATCCAGCACCAGAGAAGG + Intronic
1151945792 17:77319284-77319306 GTCCCCACCAGCACATGGTCAGG - Intronic
1152322733 17:79617258-79617280 GACCCCCCCATCCCCAGAGCAGG - Intergenic
1152558713 17:81067354-81067376 GGACCCTCCAGCACCTGAGCAGG + Intronic
1152647445 17:81476039-81476061 ATCCTCCCCAGCACCAGAGTTGG - Intergenic
1153804897 18:8703549-8703571 GACCACAACAGCAGCAGAGCAGG + Intergenic
1157199358 18:45646044-45646066 TTCTCCAGCAGCCCCAGAGCAGG - Intronic
1157778024 18:50412240-50412262 GTCTCCACATGCACCAGAGTTGG + Intergenic
1160875602 19:1295051-1295073 GTCCCCAACAGCCCCACGGCAGG - Intronic
1161152457 19:2716878-2716900 GTTCCCACCAGGACCAGAGGAGG - Exonic
1162546383 19:11333051-11333073 TTCTCCATCAGCCCCAGAGCTGG - Intronic
1163435819 19:17294499-17294521 GCCTCCACCACCACCAGGGCCGG - Exonic
1163440652 19:17320935-17320957 ATCCCCACCACCACCAGTGGGGG - Exonic
1163535549 19:17874334-17874356 GTCCCCTCCCACACCACAGCCGG + Intronic
1163646915 19:18494829-18494851 GGCCCCACCCGTACCTGAGCTGG + Intronic
1163817565 19:19476058-19476080 GTCCCCTCCATGACCAGAGGAGG - Intronic
1165757893 19:38304743-38304765 CTCCCCGCCAGCCCCAGTGCGGG - Intronic
1166204438 19:41259868-41259890 CTCCCCAGCAGCCCCAGGGCAGG + Exonic
1168685726 19:58347896-58347918 GACCCCAGAAGCCCCAGAGCAGG - Intronic
926494050 2:13561891-13561913 TATCCCACCAGCACCAGGGCAGG - Intergenic
927846560 2:26475312-26475334 GACCCCAGCAGCACCACACCTGG - Intronic
930426662 2:51221706-51221728 GTCCTCACCAGAACCTGACCAGG - Intergenic
930693127 2:54384924-54384946 GTCCCTGGCAGCACCACAGCAGG + Intergenic
931516938 2:63055529-63055551 GCCGCCAGCAGCAGCAGAGCGGG + Exonic
931778743 2:65562164-65562186 GGTCCCACCAGCACCAGGGCTGG + Intergenic
931990340 2:67783684-67783706 CTTCCCACCAGAACCAAAGCAGG - Intergenic
932593014 2:73078485-73078507 GTCACCACCACCACCAGGGAGGG + Intronic
937002779 2:118483382-118483404 CTCCCTCCCAGCAGCAGAGCTGG + Intergenic
937368812 2:121284311-121284333 GTCCCGGCCAGCAGCAGAACAGG + Intronic
937863330 2:126730322-126730344 GTCCCATCCAGCTCCAGCGCAGG + Intergenic
942455671 2:176136742-176136764 CTCCCCACCAGCTCCGGAGGTGG - Intergenic
943345421 2:186732952-186732974 GTCACAACCAGCACCAGGGAAGG - Intronic
945062512 2:205921583-205921605 ATCTCCACCATCACCAGGGCAGG - Intergenic
946135623 2:217644572-217644594 GTCACCACCAGGGCCAGGGCTGG - Intronic
947721089 2:232369720-232369742 GTACCCACTCACACCAGAGCTGG - Intergenic
948067377 2:235091326-235091348 GTGCCCACCACCACCACACCTGG + Intergenic
948407567 2:237733873-237733895 GCCCCCACCAAGCCCAGAGCCGG + Intronic
948423043 2:237872239-237872261 GCCCCCGGCAGCACCAGGGCAGG - Intronic
949022564 2:241749731-241749753 GTCACCACCAGCATCAAATCAGG - Intronic
949022591 2:241749861-241749883 GTCACCACCAGCATCAGATCAGG - Intronic
949022597 2:241749902-241749924 GTCACCACCAGCATCAGATCAGG - Intronic
949022605 2:241749946-241749968 GTTACCACCAGCATCAGATCAGG - Intronic
1170154983 20:13261270-13261292 GTGCCCACCACCACCACACCTGG - Intronic
1170567619 20:17615812-17615834 GTGCCCAGCAGCACCTGGGCTGG - Intronic
1170697718 20:18674816-18674838 GTCTCCACCAGCACAACTGCAGG - Intronic
1171324425 20:24278638-24278660 GTTCCCACAGGCACAAGAGCAGG - Intergenic
1171350233 20:24496261-24496283 GGTCCCATCAGCACCACAGCTGG - Intronic
1172703211 20:36864825-36864847 GTCCCCACCAGGAGCAGTGCAGG + Intergenic
1173160419 20:40648072-40648094 GTCCTCAACAGCACCAAAGAAGG + Intergenic
1173288163 20:41691442-41691464 GTCCCCACAGGCACAAGAGGAGG + Intergenic
1175218146 20:57402291-57402313 GTCTCCACCACCACCAAGGCAGG + Intronic
1176198154 20:63847509-63847531 CTCCCCACAAGCCCCACAGCTGG - Intergenic
1176292924 21:5055741-5055763 GTCCCCACCATCGCCGGGGCTGG + Intergenic
1176417251 21:6483855-6483877 GCCCCCACAAGGAGCAGAGCAGG + Intergenic
1179202363 21:39236452-39236474 GCCCAGACCAGCCCCAGAGCAGG + Intronic
1179217908 21:39383094-39383116 GTGCCCACCACCACCACAACCGG + Intronic
1179218476 21:39386635-39386657 GTCCCTGCCAGCAGTAGAGCAGG - Intronic
1179244457 21:39619226-39619248 GTCCTCACCAGAACCTGATCAGG - Intronic
1179692747 21:43092188-43092210 GCCCCCACAAGGAGCAGAGCAGG + Intergenic
1179709579 21:43205538-43205560 CTCCCCACCAGCAGCCCAGCTGG - Intergenic
1179864336 21:44207909-44207931 GTCCCCACCATCGCCGGGGCTGG - Intergenic
1181531887 22:23521791-23521813 CCCCCCACCACCACCCGAGCAGG + Intergenic
1182549532 22:31093433-31093455 GTCCCCACCAGCACCATGCCGGG + Intronic
1183935594 22:41260352-41260374 GCCCCCACCAGCTCCAGAGGAGG + Intronic
1184074088 22:42165099-42165121 TTCCCCACCAGCCCCAGCCCAGG - Intronic
1184154625 22:42659172-42659194 ATCCCCACCAGCAACACAGGAGG + Intergenic
1184758708 22:46532922-46532944 TTCACCTCCAGCCCCAGAGCAGG + Intronic
1185373509 22:50471521-50471543 TTCCCCACAAGCAGCAGAGCCGG - Intronic
949825026 3:8156264-8156286 CTCCCCACCCCCACCAGAGCCGG - Intergenic
950566346 3:13772005-13772027 TTCCTGACCAGCACCAGAGCTGG + Intergenic
951177594 3:19619320-19619342 GTCCCAAGCAGCACCCAAGCAGG + Intergenic
952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG + Intronic
954219129 3:49142003-49142025 GTGACCACCAGCACCAGTACTGG - Intergenic
954383263 3:50230813-50230835 GGCCTCACGAGCACCAGAGGAGG - Intronic
954396385 3:50295562-50295584 GCCACCCCCAGCACCAGGGCTGG + Exonic
954397028 3:50298408-50298430 GGCCCCAGCAGCACCAGCACTGG + Intronic
956175649 3:66471033-66471055 GTCCCCACCAACTGCAGAGCTGG - Intronic
962204154 3:133421401-133421423 TTGCCCGCCATCACCAGAGCTGG - Intronic
965099563 3:164278544-164278566 CTCCCCACAACCACCACAGCTGG - Intergenic
967727919 3:192879297-192879319 GATGTCACCAGCACCAGAGCTGG + Intronic
968052936 3:195668551-195668573 GCCCACACCAGCACCAGCGACGG + Intergenic
968102875 3:195979812-195979834 GCCCACACCAGCACCAGCGACGG - Intergenic
968582246 4:1400542-1400564 GCACCCACTGGCACCAGAGCTGG + Intergenic
968626056 4:1627180-1627202 GTCCCCACCGGCCCCAGCACTGG + Intronic
968879676 4:3292706-3292728 GTCGCTCCCAGCACCAGGGCCGG + Intergenic
968958351 4:3730418-3730440 GCCCCCACCAGCACCCGCCCTGG - Intergenic
970368473 4:15384893-15384915 GCCCTCACCAGCACCATAGCAGG + Intronic
971427923 4:26534028-26534050 TTCCCCACCAACAGTAGAGCAGG + Intergenic
972630440 4:40837250-40837272 GTCCCATGCAGCAACAGAGCTGG - Intronic
973309058 4:48687452-48687474 GCCCTCCCAAGCACCAGAGCTGG - Intronic
974781884 4:66562679-66562701 GTCCCCAGCAGCAGCAGGTCTGG + Intergenic
975814231 4:78201176-78201198 GTTCCCACCAACACCAGAAAAGG - Intronic
975923924 4:79426395-79426417 GTCACCACCACCCCCAGGGCTGG + Intergenic
978407825 4:108398567-108398589 GTCTCCAGCAGCCCCATAGCTGG - Intergenic
982309357 4:153968325-153968347 GTCCCCCATAGCATCAGAGCTGG - Intergenic
982668341 4:158292394-158292416 GCCCCCACCAGGAACAAAGCTGG - Intergenic
985703587 5:1387997-1388019 CTCCCATCCAGCACCAAAGCGGG + Intergenic
985894317 5:2739805-2739827 GTCCCGACCACCACGGGAGCAGG + Intergenic
986980748 5:13445936-13445958 ATCCCCATCAGCACCAGCTCTGG - Intergenic
987032145 5:13986075-13986097 GTGCCCACCAGCAAGAGACCTGG + Intergenic
988275819 5:29080026-29080048 GTCCCCACCCCCACGAGAGCTGG - Intergenic
991420028 5:66431296-66431318 ATCCCCACCAACACTAGAGAAGG + Intergenic
996841299 5:127850220-127850242 GTCCCCACTTGCCCCTGAGCTGG - Intergenic
997791870 5:136769163-136769185 GGCCACACCAGGACCAGGGCAGG + Intergenic
998336219 5:141374657-141374679 GTGCCCTCCAGCACCAGCTCCGG - Exonic
998692139 5:144598797-144598819 GTCACCTGCAGCACCAGGGCCGG + Intergenic
1000084499 5:157877484-157877506 GCCCACACCAGCACCACAACTGG + Intergenic
1001129019 5:169047876-169047898 GTCCTGAGCAGCTCCAGAGCAGG + Intronic
1001350822 5:170962284-170962306 ATCCCCACCAGCAAGAGAGTAGG - Intronic
1001933078 5:175686944-175686966 GTGCCCACGAGGATCAGAGCAGG - Intergenic
1002000494 5:176194091-176194113 CTCCACTCCAGCAGCAGAGCTGG + Intergenic
1002067971 5:176661848-176661870 GTCCCCACTGGCAGCAGGGCAGG - Intergenic
1002253842 5:177944890-177944912 CTCCACTCCAGCAGCAGAGCTGG - Intergenic
1003452950 6:6253560-6253582 GTTCCCACCGGAAGCAGAGCTGG + Intronic
1003665335 6:8106519-8106541 GTGCCCACCACCACCACAGCTGG - Intergenic
1006577968 6:35059740-35059762 GTCCCCACAGGCACTAGAGGGGG - Intronic
1007767495 6:44169651-44169673 GGCCCCACCTTCATCAGAGCTGG + Intronic
1014116845 6:117675870-117675892 GTCACCACCGGCACCCGCGCGGG + Exonic
1015999679 6:139029579-139029601 GTCACCGCCGGCACCAGTGCAGG - Intronic
1018478460 6:164166803-164166825 GTGCCCACAGGCACCTGAGCAGG - Intergenic
1018927628 6:168217449-168217471 GTTCCCACCAGCAGGAGACCTGG - Intergenic
1019314120 7:376759-376781 GTGCCCCCCAGCAGGAGAGCAGG + Intergenic
1019415223 7:923962-923984 GGCCCCACGAGCCACAGAGCCGG + Intronic
1019416006 7:926757-926779 GGCTCCACCAGCACCAGGACGGG + Intronic
1019586910 7:1809968-1809990 GTGCCCAGCGACACCAGAGCTGG + Intergenic
1019612669 7:1944854-1944876 GTCCCCATCAGCTGCAGAGGTGG - Intronic
1019960483 7:4455335-4455357 GTCCTCACCAGAACCAGAACCGG + Intergenic
1020185684 7:5957648-5957670 GTACCCACCACCACCACGGCCGG - Intronic
1020297232 7:6767108-6767130 GTACCCACCACCACCACGGCCGG + Intronic
1023681776 7:42694806-42694828 ATCCCCACCATCACCATAGTGGG + Intergenic
1023852822 7:44159592-44159614 GTCCAGACCTGCACCAGCGCGGG - Intronic
1024095731 7:45981043-45981065 GTCCCTTCCAGGACCAGTGCTGG + Intergenic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1029331445 7:99859561-99859583 ATCCCCACCAGCTGCACAGCTGG - Intronic
1034169758 7:149053977-149053999 TTCCCAACCAGAACCAGACCAGG + Intergenic
1034251314 7:149692894-149692916 GCCCCCACCAGCTCCGGCGCTGG + Intergenic
1034734931 7:153420104-153420126 ATCCCAGCAAGCACCAGAGCAGG - Intergenic
1035236136 7:157498721-157498743 GTCTTCACCAGGCCCAGAGCTGG - Intergenic
1037616784 8:20526402-20526424 CTCCCCACCACCGCCATAGCTGG + Intergenic
1037889499 8:22616107-22616129 GTCCCCACCTGAACCTGAGAAGG + Exonic
1039928136 8:41957883-41957905 GTCCCTACCAGATCCAGAGTTGG - Intronic
1040977276 8:53207759-53207781 ATCCCCATCACCACCACAGCTGG - Intergenic
1041293659 8:56332898-56332920 TCCCCCACCACCACCAGAACAGG - Intergenic
1045952260 8:107865417-107865439 CCTCCCACCACCACCAGAGCAGG - Intergenic
1048299167 8:133238914-133238936 GTTCCCAGCAGCACCCGAGTTGG + Exonic
1048343359 8:133557364-133557386 GTGCCCTCCTGCACTAGAGCAGG - Intronic
1048589087 8:135804419-135804441 GTCTCCACCAACACCAGAGTAGG - Intergenic
1049210701 8:141385182-141385204 GTCCCCACCAGGCCCAGAAGAGG - Intergenic
1049210712 8:141385243-141385265 GTCCCCACAGGGAGCAGAGCAGG - Intergenic
1049455831 8:142686525-142686547 GTCCCCACAGGCACCTGAGAAGG - Intergenic
1053787025 9:41659423-41659445 GCCTCCTCCAGCACCAGAGAGGG + Intergenic
1054158035 9:61654764-61654786 GCCTCCTCCAGCACCAGAGAGGG - Intergenic
1054477808 9:65585769-65585791 GCCTCCTCCAGCACCAGAGAGGG - Intergenic
1056271836 9:84954745-84954767 GTCCCCACCAGCACCAGAGCTGG - Intronic
1056707507 9:88964757-88964779 GTCCCCTTCAGCCCCAGAGAAGG + Intergenic
1057211257 9:93202262-93202284 GTCCCCACACGCAGCAGGGCTGG - Intronic
1057212429 9:93207391-93207413 CTCCCCACCAGCTCCTGAGGAGG + Intronic
1057274637 9:93669839-93669861 GGCCCCACCAGGACCAGTCCTGG - Intronic
1057323485 9:94036630-94036652 GTAGCCACCAGAATCAGAGCAGG - Intronic
1057335255 9:94150279-94150301 GGCCCCAACAGAACCAGTGCAGG - Intergenic
1057410653 9:94814193-94814215 GGCCCCAACAGGGCCAGAGCAGG - Intronic
1058327339 9:103715248-103715270 AGCTCCACCAGCACCACAGCTGG + Intergenic
1059119776 9:111631489-111631511 GGCCGCACCAGCAGCAGCGCCGG - Exonic
1059186120 9:112272675-112272697 GCCCAGACCAGAACCAGAGCAGG - Intronic
1060276632 9:122187512-122187534 GCCCCCACCAAAACCAGTGCAGG + Intronic
1061008347 9:127941254-127941276 CTCCCCAACAGCGCCAAAGCTGG + Exonic
1061626139 9:131841832-131841854 GACCCCAACAGCCCCAGAGCCGG + Intergenic
1061669891 9:132182777-132182799 GACCCCACCAGGAGCGGAGCGGG + Intronic
1061727966 9:132591423-132591445 CCCCCCACCAGAGCCAGAGCTGG - Intergenic
1061802684 9:133120908-133120930 CTCCCCACCCGCGGCAGAGCTGG - Intronic
1061814487 9:133186239-133186261 GGCGCCTCTAGCACCAGAGCTGG - Intergenic
1061942836 9:133892233-133892255 GTTCCCACTGGCACCTGAGCAGG - Intronic
1062105326 9:134752069-134752091 GCCCCCACCTGCACCAGTGCAGG - Intronic
1062117384 9:134816730-134816752 GTCCCCACCACAACCTGGGCAGG - Intronic
1062125813 9:134861785-134861807 GGCCCCACCTGAACCACAGCTGG - Intergenic
1062378978 9:136277639-136277661 GTCCCCAGCAGCAGCGGAGGGGG + Intergenic
1186044481 X:5520025-5520047 GTCCCCACTAACACCAAAGGGGG - Intergenic
1186489595 X:9961126-9961148 CTCCCCACCAGCCCTAGAACTGG - Intergenic
1186516759 X:10172022-10172044 GTTCCCACCATTCCCAGAGCTGG - Intronic
1187894054 X:23964482-23964504 GGCCCTCCCAGCTCCAGAGCTGG - Intergenic
1188504845 X:30871344-30871366 ATCTCCACCAGCTCCAGTGCTGG + Intronic
1190099706 X:47513262-47513284 GTCACCACCGGCACCCGCGCGGG - Intergenic
1191101060 X:56729257-56729279 GTCCCCTCCAGGCACAGAGCTGG - Intergenic
1193212325 X:78821832-78821854 ATCACTACCAGCACCACAGCAGG - Intergenic
1200018227 X:153181245-153181267 GTCCTCACCTGCCCCAGATCTGG - Intronic
1200118854 X:153781094-153781116 GTCCCCACCACCGCCCGTGCTGG - Exonic
1200230629 X:154442221-154442243 GGCTCCAACAGCTCCAGAGCCGG - Exonic