ID: 1056273358

View in Genome Browser
Species Human (GRCh38)
Location 9:84968566-84968588
Sequence TGAACCTGACTAATATGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056273353_1056273358 7 Left 1056273353 9:84968536-84968558 CCTACCAGCTCTCCAGCTTTGGG 0: 1
1: 0
2: 1
3: 25
4: 262
Right 1056273358 9:84968566-84968588 TGAACCTGACTAATATGCCAAGG No data
1056273351_1056273358 11 Left 1056273351 9:84968532-84968554 CCAGCCTACCAGCTCTCCAGCTT 0: 1
1: 0
2: 3
3: 17
4: 327
Right 1056273358 9:84968566-84968588 TGAACCTGACTAATATGCCAAGG No data
1056273355_1056273358 3 Left 1056273355 9:84968540-84968562 CCAGCTCTCCAGCTTTGGGTCAT 0: 1
1: 0
2: 4
3: 25
4: 224
Right 1056273358 9:84968566-84968588 TGAACCTGACTAATATGCCAAGG No data
1056273356_1056273358 -5 Left 1056273356 9:84968548-84968570 CCAGCTTTGGGTCATTCCTGAAC 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1056273358 9:84968566-84968588 TGAACCTGACTAATATGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056273358 Original CRISPR TGAACCTGACTAATATGCCA AGG Intronic
No off target data available for this crispr