ID: 1056273947

View in Genome Browser
Species Human (GRCh38)
Location 9:84974791-84974813
Sequence AGCCAGCAGGGATAAGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 261}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056273947_1056273952 3 Left 1056273947 9:84974791-84974813 CCCTTGCCTTATCCCTGCTGGCT 0: 1
1: 0
2: 2
3: 31
4: 261
Right 1056273952 9:84974817-84974839 GCTTTCCCTAAGCAGCCTCAAGG No data
1056273947_1056273955 13 Left 1056273947 9:84974791-84974813 CCCTTGCCTTATCCCTGCTGGCT 0: 1
1: 0
2: 2
3: 31
4: 261
Right 1056273955 9:84974827-84974849 AGCAGCCTCAAGGAAGTCGCCGG No data
1056273947_1056273959 30 Left 1056273947 9:84974791-84974813 CCCTTGCCTTATCCCTGCTGGCT 0: 1
1: 0
2: 2
3: 31
4: 261
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data
1056273947_1056273958 22 Left 1056273947 9:84974791-84974813 CCCTTGCCTTATCCCTGCTGGCT 0: 1
1: 0
2: 2
3: 31
4: 261
Right 1056273958 9:84974836-84974858 AAGGAAGTCGCCGGCTGTTTGGG No data
1056273947_1056273957 21 Left 1056273947 9:84974791-84974813 CCCTTGCCTTATCCCTGCTGGCT 0: 1
1: 0
2: 2
3: 31
4: 261
Right 1056273957 9:84974835-84974857 CAAGGAAGTCGCCGGCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056273947 Original CRISPR AGCCAGCAGGGATAAGGCAA GGG (reversed) Intronic
901494805 1:9614865-9614887 AGCCAGCAGGCATCATTCAAAGG - Intronic
904170655 1:28590243-28590265 AGGAAGCAGGGATCAGGGAAGGG + Intronic
904609390 1:31716694-31716716 AGACAGCAAGGATGAGGCCAGGG - Intergenic
905150286 1:35921764-35921786 AGCCAGCAGGAAAAAAGTAAAGG - Exonic
906207783 1:43996315-43996337 AGACACCAGGGATCTGGCAAGGG - Exonic
906281153 1:44554753-44554775 AGCAAGCAGGTAGAAGGCAACGG + Intronic
906886034 1:49650282-49650304 AGGCAGCAAGAATATGGCAAAGG + Intronic
907487534 1:54787959-54787981 AGCCAGCAGGGTAAGGGCAGAGG - Intronic
909298363 1:73980574-73980596 AGCCAGCATGAAAAAGGCTAAGG - Intergenic
912695281 1:111836882-111836904 AGCCACCAGGGACAAGTGAAGGG - Intronic
914017673 1:143835516-143835538 AGAGAGAAGGGAGAAGGCAAGGG - Intergenic
914341025 1:146760707-146760729 AGCTAGAAGAGATAAGGAAACGG - Intergenic
914656283 1:149744051-149744073 AGAGAGAAGGGAGAAGGCAAGGG - Intergenic
914833494 1:151188541-151188563 AGCCTGCAGGGAGTAGGCATGGG - Intronic
915697846 1:157762327-157762349 AGCCAGCATGGTTTGGGCAATGG - Intronic
917782481 1:178412900-178412922 TTCCAGCAGGGAGAAGGGAAAGG + Intronic
918091531 1:181299420-181299442 AGCTAGCACAGATAAGGAAAGGG - Intergenic
918128745 1:181606729-181606751 AGCCAGCATGGGTAAAACAAGGG - Intronic
918256870 1:182756700-182756722 AGCAAACAGGGAGAAGGCAGAGG - Intergenic
918413684 1:184286259-184286281 TGCCAGCATGGATAGGACAAGGG - Intergenic
919812380 1:201417260-201417282 AGTCATCAGGCATCAGGCAAGGG + Intronic
919983452 1:202657029-202657051 GGCCAGCAGGGCAGAGGCAATGG - Intronic
920365031 1:205443826-205443848 AGCGGGCAGGGATACGGAAATGG - Intronic
922340035 1:224647745-224647767 AGCCAGCAGGGCAGAGGGAAGGG + Intronic
923849188 1:237774677-237774699 AGCCAGGAGAGGTAAGGAAATGG - Intronic
924124793 1:240839163-240839185 AGCTAACTGGGATAAGGCAGAGG - Intronic
924884191 1:248194863-248194885 AGTCAGCAGGAATAAGGCAGCGG - Intergenic
924893024 1:248305768-248305790 AGTCAGCAGGAATAAGGCAACGG + Intergenic
1063544003 10:6962297-6962319 AGGTAGGAGGGATAGGGCAAGGG - Intergenic
1063566400 10:7175117-7175139 AGCCAGCTGGGATGTGACAAGGG - Intronic
1065047182 10:21754833-21754855 AGCCAGCAGGGACAGGGAAGTGG - Intergenic
1066532889 10:36359591-36359613 AGCCAGGAAGGGTAAGGGAAGGG - Intergenic
1067804673 10:49384565-49384587 AGCCAGAAGGGCTTAGGGAAGGG + Intronic
1067995869 10:51272650-51272672 ACCCAGCTGGGAAAAGGCCAAGG - Intronic
1070808567 10:79285749-79285771 AGGCAGAAGGGAGAAGGCAGAGG + Intronic
1071309987 10:84334092-84334114 AGCCATCAGGGAGGAGGCAGAGG + Intronic
1071464670 10:85928344-85928366 AGCGGACAGGGATAGGGCAAGGG + Intronic
1071894638 10:90052215-90052237 AGACAACAGGAATAAGGTAAAGG - Intergenic
1072501548 10:96023109-96023131 AGCCAGCATCTCTAAGGCAAGGG + Intronic
1073148869 10:101298297-101298319 AGCCAGCAGGCAGCAGGCAGGGG + Intergenic
1073245947 10:102090327-102090349 AGCCAGCACCTATTAGGCAAAGG + Intergenic
1077494613 11:2880830-2880852 AGGCAGGAGAGATAAGGCAGGGG - Intergenic
1077782737 11:5349125-5349147 TGGCTGCAGGGATGAGGCAAAGG + Intronic
1083602627 11:63958366-63958388 AGCCGGCAGGGATGAAGGAATGG - Intergenic
1084092605 11:66888488-66888510 AGCCAGCACAGAGGAGGCAAAGG + Intronic
1084317822 11:68355484-68355506 AGCCAGCTGGGATGAGCCACAGG - Intronic
1084423518 11:69072118-69072140 AGCCAGCAGGGGCGAGGCACAGG - Intronic
1084958356 11:72703314-72703336 AGCCAGCAGGGGTGAGGCCCCGG - Intronic
1084991064 11:72925999-72926021 AGCCAGCAGGGACAGGGGCAGGG - Intronic
1085278107 11:75312835-75312857 AGCCAGCAGAGGCAAGGGAATGG + Intronic
1086349559 11:85932073-85932095 AACCAAGAGGCATAAGGCAAAGG + Intergenic
1086380343 11:86245521-86245543 AGCAAGCAGGAACTAGGCAAAGG + Intronic
1087268039 11:96082511-96082533 AGCCAGTAGGGATCAGACAGTGG + Intronic
1087329394 11:96760959-96760981 AGGCAGAAGGGCAAAGGCAAGGG - Intergenic
1088431965 11:109768524-109768546 ACCCATCAGGAATAAGGCCAGGG + Intergenic
1089284286 11:117395735-117395757 AGCCAGCAGGGCTAAGTGCAGGG - Intronic
1090039323 11:123276493-123276515 AGCCAGAAGTGAAAAGGGAAGGG - Intergenic
1090803770 11:130190049-130190071 AGGAAGCAGGAATAAGGAAATGG + Intronic
1091393795 12:141514-141536 AGGCAGCAGGGATACAGAAATGG + Intronic
1091987382 12:4922609-4922631 ACCCACCAGGTATAAAGCAAGGG + Intronic
1092515492 12:9207381-9207403 AGGCAGCTGGGTTAAGGCCAGGG + Intronic
1096331331 12:50715674-50715696 AGCCAGCAGGTAGGAGGAAAAGG + Intronic
1097142191 12:56911301-56911323 AGCCAGCAGGAATGGGGAAAGGG - Intergenic
1102422597 12:112815828-112815850 GGTAAGCAGGGAAAAGGCAAAGG - Intronic
1102478252 12:113202659-113202681 AGCCAGCAGGAAGGAGGAAAGGG - Intronic
1104351804 12:128050477-128050499 GGCCAGGAAGGATAAGGGAAAGG + Intergenic
1104568960 12:129908640-129908662 AGGCACCAGGGAGAAGGCAAAGG + Intergenic
1104574067 12:129950512-129950534 ACCCACCATGGCTAAGGCAATGG - Intergenic
1107646185 13:42496546-42496568 AGCCAGCAGGGACAAGGCGTGGG - Intergenic
1109142345 13:58730174-58730196 AGCCAGGAAGGTTTAGGCAATGG + Intergenic
1109680605 13:65747531-65747553 AGCCTGGAGGGATAAGGGAGAGG - Intergenic
1113386274 13:109851284-109851306 AGTGAGCAGGAATAAGGCAGTGG + Intergenic
1119775613 14:77246490-77246512 GGCCAGCTGGAATAAAGCAAGGG + Intronic
1121231787 14:92363886-92363908 AGGCAGCAGGGACCAGGCGAGGG - Intronic
1121839283 14:97119174-97119196 AGCCAGAAGGGTTAAGAGAATGG - Intergenic
1124686083 15:31783079-31783101 AACCAGCAAGGAGAAGGGAAGGG + Intronic
1124888777 15:33712125-33712147 TGAAAGCAGGCATAAGGCAAGGG + Intronic
1125404506 15:39338471-39338493 GGCCAGCAGGGCTTAGCCAAAGG + Intergenic
1126551074 15:49930135-49930157 AGCAAGGAGGGATAAGGAATGGG + Intronic
1128236705 15:66072654-66072676 AGCCAGCAGGGAGAAGGCTCAGG - Intronic
1128715031 15:69901534-69901556 AGCCAGCAGGGGTGAGGAAGTGG + Intergenic
1129182445 15:73885703-73885725 AGCCAACTGGGACAAGGGAAGGG - Intronic
1129296404 15:74602576-74602598 AGGCAGCAGGGATCGGGCATGGG + Intronic
1132328531 15:100993828-100993850 AACCAGCAGGAATAAGGGAAGGG - Intronic
1132621198 16:868976-868998 TGCCAGCAGGGACAAGGCCTCGG + Exonic
1134276348 16:12779929-12779951 AGCAAGCAGGTATAAGCAAACGG - Intronic
1135393997 16:22117091-22117113 AGCCTGCAGGGATGAGGCCAGGG - Exonic
1138251598 16:55505895-55505917 AGCCAGCAGTGAAAAGCCAGGGG - Exonic
1139530202 16:67538905-67538927 AGACAGCAGGGAGAGGGCATGGG - Intronic
1139590096 16:67928599-67928621 AGCCTGAAGGGAAAAGGCAATGG - Exonic
1140341342 16:74166773-74166795 CACCAGCAGGGAGAAGACAAGGG + Intergenic
1141270755 16:82539120-82539142 AGCCTACAGGGAGAAGGAAAAGG + Intergenic
1141477671 16:84284472-84284494 AGGGAGCAGGGATATGGGAAAGG - Intergenic
1142376309 16:89708752-89708774 AGCCAGCTGGCACAAGGCTAAGG + Intronic
1143286190 17:5790973-5790995 ATCCAACAGGGATGATGCAAAGG - Intronic
1143391589 17:6561862-6561884 CACCAGCAGGGAAAAGGAAAAGG - Intergenic
1144029197 17:11304488-11304510 AGCCAGCAGAGAGAAGCAAAGGG + Intronic
1144174241 17:12689084-12689106 AGAAAGCAAGGATAAGGGAAAGG - Intronic
1144674881 17:17155567-17155589 AGTCCGCAGGAAGAAGGCAAAGG - Intronic
1148515362 17:48211856-48211878 AGCCAGCAGGAAGGAGGAAAGGG + Intronic
1148674055 17:49434836-49434858 AGCCAGAAGGGATGAGGCGGGGG + Intronic
1151757298 17:76082139-76082161 AGCCAGCAGGGTGGATGCAAGGG - Intronic
1152006869 17:77687899-77687921 AGGCAGCAGGGATAACTCAGAGG + Intergenic
1152570092 17:81117904-81117926 AGCCACCAGGAACCAGGCAAGGG + Exonic
1153074147 18:1143700-1143722 AGAGAGCAGGGAGAAGGAAAAGG - Intergenic
1153665761 18:7366778-7366800 AGCCTGCTGGGATAAGCCAGAGG - Intergenic
1153902471 18:9630046-9630068 AGCCAGCTGGGGAAGGGCAAAGG - Intergenic
1158155000 18:54415853-54415875 AGGCAAAAGGGAAAAGGCAATGG - Intergenic
1159049359 18:63404333-63404355 AGACAGAAGGGAGAAGGAAAAGG + Intronic
1159583469 18:70261026-70261048 AGCCAGCAGGCAAACGCCAATGG + Intergenic
1159941463 18:74412085-74412107 ACCCAGCAGGGACAGGGCAGAGG + Intergenic
1162310900 19:9906745-9906767 AGCCAGGCGGGAAAAGGCAGAGG - Intronic
1162371692 19:10283801-10283823 AGCCAGCAGGGAGAAGGTGGGGG + Intronic
1162902019 19:13800753-13800775 AGGCAGCAGGGTTTAGACAAGGG + Intronic
1163114128 19:15179031-15179053 AGCCAGCATGACAAAGGCAACGG + Exonic
1167571727 19:50292874-50292896 AGGCAGGAGGGAGAAGGCTATGG + Intronic
926045244 2:9705043-9705065 AGCAGGTAGGGATAAAGCAAGGG + Intergenic
928600640 2:32900726-32900748 AGGCAGCAGGGACAAGGGACAGG + Intergenic
928653071 2:33422307-33422329 AGGCATCAGGGATAAGACAATGG - Intergenic
929207793 2:39317768-39317790 AGGCAGCAGGGAAAAGGGAACGG + Intronic
931754370 2:65359301-65359323 AGGCAGCAAGGATAATGTAAAGG + Intronic
932492498 2:72131211-72131233 CTCCACCAGGGATAAGGCAGAGG + Exonic
932759209 2:74428585-74428607 AGGGAGCAGGGAGAAGGCAGAGG - Intronic
932862913 2:75313166-75313188 AAACAGAAGGGATGAGGCAAGGG + Intergenic
933154108 2:78952183-78952205 AGGCAGCAGGGATGAGGAGAGGG - Intergenic
933263063 2:80151616-80151638 AGCAAGAAGGAATAAGACAATGG - Intronic
933486864 2:82935287-82935309 AACCAGCAGGAATCAGCCAATGG + Intergenic
933764105 2:85695463-85695485 AGCCACCAGGGAGGAGGGAAAGG - Intronic
934604249 2:95682289-95682311 AGGCAGCAGGGATAAGGATGGGG + Intergenic
936278430 2:111119576-111119598 AGCCGGCAGGGAGAAGGAAGGGG - Intronic
936537644 2:113324514-113324536 AGGCAGCAGGGATAAGGATGGGG + Intergenic
937514719 2:122640426-122640448 AGCTAGCAGGGATTGGGCACTGG + Intergenic
938011335 2:127831383-127831405 CGCCAGCATGGAGAAGGCACTGG + Intergenic
938580557 2:132642430-132642452 AGCCTCCAGGTACAAGGCAAAGG - Intronic
939801753 2:146720175-146720197 AGCCAGCAGGAATCAGGAACAGG + Intergenic
940639910 2:156334294-156334316 GGGCAGCAGGGAGTAGGCAAAGG - Intronic
942933563 2:181526578-181526600 AGCCAGCAGGGATCATGAGATGG + Intronic
944711444 2:202338328-202338350 AGGCTGCAGGGGTAAGGCCACGG + Intergenic
945258492 2:207822733-207822755 AGCCAGCAGGGAAGAAGCAAAGG + Intergenic
945277229 2:208000197-208000219 AGCCAGCAGTAACAAGGAAATGG - Intronic
945820062 2:214653040-214653062 AGCCAGCTGAGAAGAGGCAATGG + Intergenic
946927734 2:224642498-224642520 AGTCATCAGGGATGAGGCAGGGG + Intergenic
948029423 2:234804919-234804941 AGCCAGCTGGGATCATGCCAAGG + Intergenic
948227717 2:236324708-236324730 AGGCAGCACAGAAAAGGCAAAGG - Exonic
948833035 2:240608267-240608289 AGCCAGAGGAAATAAGGCAAGGG - Intronic
1168869073 20:1113636-1113658 AGCCAGCATGGAATAGGCACTGG - Intronic
1170074898 20:12408923-12408945 AGCCCTCAGGGATCAGGCCAAGG + Intergenic
1170129945 20:13008705-13008727 GGCCTGGAGGGATGAGGCAAAGG - Intergenic
1171180991 20:23090274-23090296 GCCCAGCAGGGATCAGCCAAAGG - Intergenic
1172187497 20:33040214-33040236 AGGAAGCAGGGAGAAGGCAGTGG - Intronic
1172317761 20:33969634-33969656 AGCCAACAGGGATGATGAAAAGG + Intergenic
1172344191 20:34184241-34184263 AGCCTTCAGGGAAAAGGAAAAGG + Intergenic
1172847032 20:37935637-37935659 AGCCAGCAGGGAAATGGGAGGGG - Intronic
1174979624 20:55378926-55378948 AGCCTGCAGGTATCAGGCACTGG - Intergenic
1175408956 20:58753459-58753481 AGCCAACAGGGAAAAGGGATAGG - Intergenic
1175675071 20:60939369-60939391 AGCCAGGAAGGATAAGGAACTGG + Intergenic
1176155237 20:63616681-63616703 TGCCAGCAGGAATGAGGGAAAGG + Intronic
1176210773 20:63920236-63920258 AGCCAGCAGGGAGCAGGGCAGGG + Intronic
1178797233 21:35756099-35756121 GGCCCACAGAGATAAGGCAAAGG + Intronic
1179051523 21:37892609-37892631 AGGCAACAGGGTGAAGGCAATGG + Intronic
1179611228 21:42552631-42552653 AGCCAGCAGGAAGGAGGGAAAGG + Intronic
1180143972 21:45909566-45909588 AGACAGCAGGGACAAGGCTCAGG - Intronic
1181064052 22:20297357-20297379 TGCCAGCAGGGCTGAGGCCAAGG - Intergenic
1182549998 22:31095747-31095769 ATCCAGCAGGGAATAGCCAAGGG - Intronic
1182997407 22:34826801-34826823 GGCCAGTAGGGAAAAGGAAAGGG - Intergenic
1183373897 22:37451003-37451025 AGCCAGATGGGGTGAGGCAAGGG + Intergenic
1184613522 22:45622127-45622149 AGCCAGCAGGGATGGGGTGAGGG - Intergenic
950077731 3:10199155-10199177 AGCCAGAAGGGATAAGATCAGGG + Intronic
950271599 3:11620405-11620427 AGCCAGCAGGGTGAGGGCAAGGG + Intronic
950613016 3:14138272-14138294 AGCCAGCAGGGTCAGGGCACTGG + Intronic
951048751 3:18070578-18070600 ATCCAGCAGGAATTAAGCAAAGG - Intronic
952238916 3:31509702-31509724 AGGCAGCAGGGAGAAGGAAGAGG - Intergenic
952729901 3:36627636-36627658 TGACAGAAGGCATAAGGCAACGG + Intergenic
953038847 3:39237223-39237245 TGCCAGCAAAGAAAAGGCAAGGG + Intergenic
953237634 3:41120243-41120265 AGCCCGCAGGGATAAGCGGAGGG - Intergenic
953660347 3:44887366-44887388 AGCCAGCAGGGTTAAACAAATGG + Intronic
954838568 3:53492868-53492890 AGCCAGCATTCATAAGGCACCGG - Intergenic
955770431 3:62379462-62379484 AGCCGGCAGGGAAAAGGGACCGG + Intergenic
956722502 3:72130782-72130804 AGCTAGCAGGAATGAGGAAAAGG + Intergenic
956887255 3:73572728-73572750 AGCCAAGAGGGATGAGGCAGAGG + Intronic
959497172 3:107065156-107065178 AGCCAGTAGGTCTAAGGCAATGG - Intergenic
962853431 3:139324833-139324855 GGCCAGCAGGGCTAAGGGATGGG + Intronic
963019977 3:140863613-140863635 GGCCAGCAGGGACAAAGCAATGG + Intergenic
963030111 3:140961911-140961933 AGCCAGCATTGGTAAGGCTATGG - Intronic
964384913 3:156137270-156137292 AAGCAGTAGGGATAAGGAAAAGG + Intronic
967494482 3:190127638-190127660 AGCCAGAAGGAGTAAGGCAAGGG - Intergenic
967886632 3:194337850-194337872 AGCCAGCAGGTCTAAGTCTAAGG + Intergenic
968137854 3:196231971-196231993 AGACTGCAGGGAGAGGGCAATGG - Intronic
968908538 4:3465335-3465357 AGGCAGCTGGGTGAAGGCAAAGG - Intronic
969276290 4:6137937-6137959 AGCCAGGAAGGAGAAGGCCATGG - Intronic
969437227 4:7195041-7195063 GGCCAGCAGGGATGGGGCACTGG + Intronic
971219037 4:24688233-24688255 AGCCATCAGGGAAGAGGCAAGGG - Intergenic
972329517 4:38051734-38051756 AGCGAGCAGAGATGAGGAAAAGG + Intronic
973730083 4:53814884-53814906 AGCCAGCAGGAAGGAGGAAAAGG - Intronic
974268579 4:59618825-59618847 AGCCATCAGGGACAAGATAATGG + Intergenic
975839213 4:78456057-78456079 AGCCAGCAGGAAGAAAGAAAAGG + Intronic
976246254 4:83008953-83008975 AGTCAGCAGCTATAAGGCATGGG + Intronic
978182338 4:105814284-105814306 AGCCAGCAGGGTTTAGGAAAAGG - Intronic
978595198 4:110369644-110369666 AGCCATCAGTGGTGAGGCAAGGG + Intronic
979613494 4:122715176-122715198 AGCCAGCATAGATAAGAAAATGG + Intergenic
979938941 4:126735591-126735613 AGCCAGTAGGGCTCAGGCACTGG - Intergenic
980075965 4:128293107-128293129 AGCCCACAGGGTTAAGGTAATGG + Intergenic
983925452 4:173396375-173396397 ATCCAGAAGAGATGAGGCAAAGG + Intronic
984816763 4:183845332-183845354 AGCCAGGTGGGATATGGCATGGG + Intergenic
985131218 4:186740506-186740528 AGCCTGAAGGGACAAGGGAAGGG + Intergenic
985308936 4:188576170-188576192 AGACACCAGAGCTAAGGCAAAGG - Intergenic
987296712 5:16559318-16559340 AGCCAGCAGGGATTAGCAAAGGG - Intronic
990528735 5:56653588-56653610 AGGCAGCAGGGCCAAGGCAGAGG - Intergenic
990534237 5:56704286-56704308 AACCAGCAGAGAAAAGGAAAAGG - Intergenic
991052525 5:62288380-62288402 AGCCAGCTGGAAGAAGGAAAAGG - Intergenic
991306733 5:65184887-65184909 AGCCGGCAGAGAAAAGGAAAGGG + Intronic
992008827 5:72507288-72507310 AGAGAGCAGGGATCAGGTAAAGG - Exonic
993642024 5:90417120-90417142 GGCCATCAGGGATCAGGCAGAGG + Intergenic
995180038 5:109222601-109222623 AGCCAGCAGGAGGGAGGCAAAGG - Intergenic
996019252 5:118573690-118573712 AGCCAGCAGGAAAACGGCAGTGG - Intergenic
996949803 5:129111763-129111785 AGACAGAAAGGAGAAGGCAAAGG - Intronic
998304863 5:141064340-141064362 AGCCAGTAGGAATCAGGAAAGGG + Intergenic
998443310 5:142179872-142179894 AGCCAGCAGGGAGGAAGAAAGGG + Intergenic
999221059 5:149978029-149978051 AGCCAGCAGGGAATAAGCAATGG - Exonic
999225960 5:150024765-150024787 AGGCAGCAGAGACCAGGCAATGG + Intronic
1002079357 5:176728264-176728286 ACCCAGCATGCAGAAGGCAAAGG - Intergenic
1002767029 6:250272-250294 AGCCAGCTGGGATAATGATAGGG + Intergenic
1003322000 6:5059994-5060016 AGCCAGCATTCAGAAGGCAAAGG + Intergenic
1004030629 6:11865247-11865269 AGACACAAGGGATTAGGCAAAGG - Intergenic
1004941393 6:20560988-20561010 AGCCAGCAGAAATAAGCTAATGG - Intronic
1005100073 6:22162422-22162444 AGGGAGCAGAGATAGGGCAAAGG - Intergenic
1006239912 6:32668612-32668634 ATGCAGCAGGGATAGGGCCAGGG - Intergenic
1006813349 6:36835079-36835101 AGCCAGCAGGGCTAAGCAATGGG + Intronic
1006856381 6:37136355-37136377 AACCAGCAAGGATTAGGCAATGG + Intergenic
1007716876 6:43861848-43861870 AGGGAGCAGGGATAGGGCAGGGG + Intergenic
1010154456 6:72776857-72776879 AGCCAGCAGACATGAGGCCAGGG + Intronic
1011212573 6:84969908-84969930 AGCAACCAGGGAGAAGTCAAGGG - Intergenic
1011227721 6:85126513-85126535 AGCCAGCAGGAGCAAGGCATGGG - Intergenic
1011554033 6:88556400-88556422 AGCCAGCAGAGACAAGGAGAAGG + Intergenic
1012976637 6:105787115-105787137 AGCCAACAGTGAAAAGGCAAAGG + Intergenic
1013255229 6:108378882-108378904 GGCAAGCAGGGAAAAGGGAAAGG - Intronic
1013544139 6:111139051-111139073 AGCCAGCAGGGAGAAGGAAAGGG - Intronic
1013962014 6:115912003-115912025 AGACAGGAGGGATAAGCCAGAGG - Intergenic
1015369878 6:132438584-132438606 AGTCAGCAGGGGTAAGGAAAAGG + Intergenic
1017452945 6:154571433-154571455 AAGTAGCAGGGAGAAGGCAACGG - Intergenic
1018618649 6:165709977-165709999 AGCCAGCAAGGAGAAAGCAGAGG - Intronic
1019698291 7:2460154-2460176 GGCCAGCAGGAATGAGACAAGGG - Intergenic
1021144667 7:17070542-17070564 AGCAAGCAGGGATGTGGCCAAGG - Intergenic
1021336871 7:19414089-19414111 AGCCACCAGGGACAATGAAAAGG + Intergenic
1021571695 7:22072507-22072529 AGCCAGCTGGGCCAAGGCAATGG + Intergenic
1024264122 7:47593685-47593707 AGCAAGCTGGGAGATGGCAAAGG + Intergenic
1024797590 7:53036756-53036778 GGCCAGCAGGGCGAAGGCAAGGG - Exonic
1025142067 7:56474872-56474894 AGCCTGCAGGCATCAGGCAGTGG - Intergenic
1025611420 7:63078180-63078202 AGCCTGCAGGAATCAGGCAGTGG + Intergenic
1025708208 7:63886305-63886327 AGCCTGCAGGCATCAGGCAGCGG - Intergenic
1026427892 7:70314868-70314890 AGACAGCAGGTACAAGGCAAAGG - Intronic
1026432328 7:70359576-70359598 AGCCGGCTGAGATAAAGCAAGGG - Intronic
1028161781 7:87493984-87494006 GGCCAGCATGGATGAGGGAAAGG + Intergenic
1029133848 7:98354623-98354645 AGCAACCAGGGAAGAGGCAAGGG + Intronic
1031830733 7:126622231-126622253 AGACAGCAGGGACAAGGTAAAGG - Intronic
1032281804 7:130509388-130509410 AGCAAGCAGGGATGAAGAAAAGG + Intronic
1036635065 8:10543574-10543596 AACCAGGAAGGATAAGGGAAAGG - Intronic
1037982138 8:23261802-23261824 AGGCAGCAGGGACAGGGCAAAGG - Exonic
1038145099 8:24888147-24888169 TGCCATCTGGGATAAGGCCATGG + Intergenic
1039880090 8:41620242-41620264 GGCCAGCAGGCAAGAGGCAATGG + Intronic
1041138009 8:54781390-54781412 AGACAGCAGCTATAAGGCAAAGG + Intergenic
1042273185 8:66976532-66976554 GGCCAGAGGGAATAAGGCAAGGG - Intronic
1043648409 8:82554244-82554266 AGCCAGCAGGGTTGTGGTAAAGG - Intergenic
1045004137 8:97902720-97902742 AGACAGGAGAGGTAAGGCAAGGG - Intronic
1047513682 8:125535146-125535168 AGACAGCAGAGATAAGACAAAGG - Intergenic
1048220431 8:132536190-132536212 AACCAGCAGGAAAAAGGCAGAGG + Intergenic
1048306301 8:133287066-133287088 AGGCATCAGGGACAAGGTAAGGG - Intronic
1048889853 8:138937182-138937204 ACCCAGCAAGGACATGGCAAGGG + Intergenic
1048896112 8:138993799-138993821 AGGCTGCAGGGATGAGGAAAAGG + Intergenic
1049021726 8:139961660-139961682 AGCCTGCAGGGATGAGGGGAGGG - Intronic
1049198511 8:141328499-141328521 AGCCAGCGGGGCTGAGGCAGGGG + Intergenic
1049551640 8:143262645-143262667 AGCCAGCAAGCAGTAGGCAAGGG - Intronic
1051158692 9:14181169-14181191 AGCTAACAGGCATGAGGCAAAGG - Intronic
1052104712 9:24498810-24498832 TGCCAGCAGGGAGAAAGCAAGGG - Intergenic
1052497989 9:29252756-29252778 AGACAGCAGAGATGGGGCAAAGG - Intergenic
1055995056 9:82148316-82148338 TGGCAGCAGGAAGAAGGCAAAGG - Intergenic
1056273947 9:84974791-84974813 AGCCAGCAGGGATAAGGCAAGGG - Intronic
1058070503 9:100596878-100596900 AGACAGGTGGGATAAGGCATTGG - Intergenic
1060402387 9:123356331-123356353 AGCCAGGAGGGAAAGGGCAGGGG - Exonic
1061328712 9:129879308-129879330 TGCCAGCAGAGATAAGGGCATGG + Intronic
1061337080 9:129946782-129946804 AGCCAACAGTCATAAGGCAAGGG + Intronic
1061681867 9:132246375-132246397 AGCCAGAAGAGTTAAGGGAAAGG + Intergenic
1061800175 9:133109362-133109384 GGCCAGCTGGGATGAGGCTATGG + Intronic
1061974284 9:134060652-134060674 AGCCAGCGGGGAGAGGGCAGTGG + Intronic
1062401423 9:136374397-136374419 AGCCTGCAGGGATGAGGCTCTGG - Intergenic
1062485650 9:136773976-136773998 AGCCAGCAGGGAGAGGAGAAGGG - Intergenic
1185597113 X:1314053-1314075 AGCCAGCAGAGATAGGGCCTAGG + Intergenic
1185925094 X:4137023-4137045 AGCCTGCAGGTAAAAGACAAAGG - Intergenic
1191912737 X:66168293-66168315 AGCCAGGAGGGAAAAGGAAGAGG + Intronic
1192313330 X:70033913-70033935 AGCCAGCAGTGTTGAGGGAAAGG - Intronic
1192322013 X:70097514-70097536 AGGCAGCAAAGAGAAGGCAAAGG + Intergenic
1193554291 X:82933522-82933544 AGCCAGGTGTGAAAAGGCAAGGG - Intergenic
1195857742 X:109349108-109349130 ATCCACCAGAGATAAGGCAGTGG + Intergenic
1197406155 X:126053718-126053740 AACATGCAGGGATGAGGCAAGGG + Intergenic
1201593514 Y:15640589-15640611 AGGCAGCAGGGATAGGATAATGG - Intergenic