ID: 1056273948

View in Genome Browser
Species Human (GRCh38)
Location 9:84974792-84974814
Sequence AAGCCAGCAGGGATAAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 281}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056273948_1056273960 30 Left 1056273948 9:84974792-84974814 CCTTGCCTTATCCCTGCTGGCTT 0: 1
1: 0
2: 2
3: 32
4: 281
Right 1056273960 9:84974845-84974867 GCCGGCTGTTTGGGAGTTAAGGG No data
1056273948_1056273957 20 Left 1056273948 9:84974792-84974814 CCTTGCCTTATCCCTGCTGGCTT 0: 1
1: 0
2: 2
3: 32
4: 281
Right 1056273957 9:84974835-84974857 CAAGGAAGTCGCCGGCTGTTTGG No data
1056273948_1056273952 2 Left 1056273948 9:84974792-84974814 CCTTGCCTTATCCCTGCTGGCTT 0: 1
1: 0
2: 2
3: 32
4: 281
Right 1056273952 9:84974817-84974839 GCTTTCCCTAAGCAGCCTCAAGG No data
1056273948_1056273958 21 Left 1056273948 9:84974792-84974814 CCTTGCCTTATCCCTGCTGGCTT 0: 1
1: 0
2: 2
3: 32
4: 281
Right 1056273958 9:84974836-84974858 AAGGAAGTCGCCGGCTGTTTGGG No data
1056273948_1056273955 12 Left 1056273948 9:84974792-84974814 CCTTGCCTTATCCCTGCTGGCTT 0: 1
1: 0
2: 2
3: 32
4: 281
Right 1056273955 9:84974827-84974849 AGCAGCCTCAAGGAAGTCGCCGG No data
1056273948_1056273959 29 Left 1056273948 9:84974792-84974814 CCTTGCCTTATCCCTGCTGGCTT 0: 1
1: 0
2: 2
3: 32
4: 281
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056273948 Original CRISPR AAGCCAGCAGGGATAAGGCA AGG (reversed) Intronic
900091227 1:921588-921610 AAGCCAGCGGGCATGAGACACGG + Intergenic
900778501 1:4601801-4601823 AAGTCAGAAAGGAGAAGGCAGGG - Intergenic
900785668 1:4648504-4648526 AAGCCACAAGGGCTATGGCATGG + Intergenic
900955825 1:5885712-5885734 AAGCCTGCAGGGTTACCGCACGG - Intronic
901732267 1:11288615-11288637 AAGGCAGCAGGGACTGGGCATGG + Intronic
902227591 1:15006449-15006471 CAGCGAGCCGGGAAAAGGCAGGG + Intronic
902846253 1:19112735-19112757 AGCCCAGGACGGATAAGGCACGG + Exonic
903300619 1:22376047-22376069 AAGAGAGCAGGGAGAGGGCAGGG - Intergenic
903578460 1:24353629-24353651 AAGACAGCAGGGAAGGGGCAAGG + Intronic
904339956 1:29828228-29828250 AGGACAGCAGGGCAAAGGCAGGG + Intergenic
904609391 1:31716695-31716717 AAGACAGCAAGGATGAGGCCAGG - Intergenic
906323882 1:44832462-44832484 AGGCCCTCAGGGATAAGGCAGGG - Intronic
907067068 1:51494668-51494690 AAGCCAGAAGGCATTAGGGAAGG + Intronic
910436802 1:87213542-87213564 AAGACAGCAGGGAGAGAGCAGGG - Intergenic
912695282 1:111836883-111836905 AAGCCACCAGGGACAAGTGAAGG - Intronic
914833495 1:151188542-151188564 AAGCCTGCAGGGAGTAGGCATGG - Intronic
916674929 1:167057404-167057426 GTGGCAGCAGGGATCAGGCAAGG - Intronic
916716511 1:167451331-167451353 AAGCCAACTGGAACAAGGCAAGG + Intronic
918091532 1:181299421-181299443 AAGCTAGCACAGATAAGGAAAGG - Intergenic
918128746 1:181606730-181606752 AAGCCAGCATGGGTAAAACAAGG - Intronic
918413685 1:184286260-184286282 ATGCCAGCATGGATAGGACAAGG - Intergenic
919812379 1:201417259-201417281 AAGTCATCAGGCATCAGGCAAGG + Intronic
920644917 1:207794788-207794810 AAGCCAGCAGGCGAAAAGCAGGG + Exonic
922116051 1:222616015-222616037 AAGACAGCTGGGACAAGGGAGGG + Intergenic
922209586 1:223477322-223477344 GAGCCAGCATGGATGAGCCAAGG + Intergenic
922558609 1:226550801-226550823 AATGCAGCAGGGCTAAGGCTGGG - Intronic
923342798 1:233021987-233022009 AAGCCAACAGGGTTAGGCCAGGG + Intronic
923752087 1:236755515-236755537 GAGCCAGCAGGTATAACTCAGGG + Intronic
1063096359 10:2912626-2912648 CATCTAGCAGGGATAGGGCAGGG - Intergenic
1063544004 10:6962298-6962320 AAGGTAGGAGGGATAGGGCAAGG - Intergenic
1065756943 10:28939535-28939557 ACTCCAGCTGGGATAAGGCGTGG - Intergenic
1066532890 10:36359592-36359614 AAGCCAGGAAGGGTAAGGGAAGG - Intergenic
1067247280 10:44557506-44557528 AAGGCAGCAGGGGTAGGTCAGGG - Intergenic
1068639362 10:59385226-59385248 AAGCCAGCATGGATTTGGCAAGG + Intergenic
1069592869 10:69652696-69652718 AAGCCTGCAGGGATAAGGGGGGG - Intergenic
1070837711 10:79460788-79460810 AAGCTAGAAGGGACAAGGAATGG - Intergenic
1070893639 10:79963016-79963038 AAGACACCAGGAATAAGGAAAGG - Intronic
1071229183 10:83565003-83565025 CAGCAAGCAAGGAGAAGGCACGG + Intergenic
1072501547 10:96023108-96023130 AAGCCAGCATCTCTAAGGCAAGG + Intronic
1073148868 10:101298296-101298318 CAGCCAGCAGGCAGCAGGCAGGG + Intergenic
1075687618 10:124375448-124375470 AACCCAGCAGGGGTGAGGCTTGG - Intergenic
1075737393 10:124672386-124672408 CAGGAAGCAGGAATAAGGCAGGG + Intronic
1076302900 10:129441522-129441544 AGCCCAGCAGGGCTCAGGCAGGG + Intergenic
1076541326 10:131216955-131216977 CAGCCAGAAGGGATGAGCCATGG - Intronic
1076794297 10:132791269-132791291 AAGCCAGCAGGGAGACTGGAAGG - Intergenic
1077351128 11:2093665-2093687 AAGCCAGCCCAGCTAAGGCAAGG + Intergenic
1077494614 11:2880831-2880853 GAGGCAGGAGAGATAAGGCAGGG - Intergenic
1079319932 11:19443227-19443249 AACTCAGCAAGGATAAGGCCTGG - Intronic
1081053745 11:38381617-38381639 AAGAAAACAGGGATAAGGTAAGG + Intergenic
1083977534 11:66135625-66135647 AGGCCAGCAGGGATGAGGGCAGG - Intronic
1084577036 11:69995730-69995752 ATACCAGCAGTGATAAGTCATGG - Intergenic
1084991065 11:72926000-72926022 AAGCCAGCAGGGACAGGGGCAGG - Intronic
1085278560 11:75315381-75315403 GAGCAAGCAGGCATAAGGCATGG - Intronic
1087329395 11:96760960-96760982 AAGGCAGAAGGGCAAAGGCAAGG - Intergenic
1087696524 11:101383392-101383414 AAGCCAAGAGGGAGAAGGGAGGG - Intergenic
1089321510 11:117629704-117629726 AAGAGAGCAGGGAGAAGCCATGG + Intronic
1090356185 11:126141787-126141809 AAGCCAGCAGGGGTCATTCATGG + Intergenic
1091075705 11:132614119-132614141 AAGGCAGTAGGCCTAAGGCATGG - Intronic
1091697944 12:2640620-2640642 GAGCAAGCAGCGACAAGGCAGGG + Intronic
1092116841 12:6015385-6015407 AAGACAGCAGAGAAAAGACAGGG + Intronic
1092515491 12:9207380-9207402 AAGGCAGCTGGGTTAAGGCCAGG + Intronic
1093936762 12:25009748-25009770 AAGCCAGCAGGCTTGAAGCAAGG + Intergenic
1094685426 12:32708818-32708840 AAGACAGCAGGATTCAGGCAAGG - Intronic
1094735970 12:33234095-33234117 AAGTCAGCAGGCAGAAAGCAGGG - Intergenic
1096515040 12:52151094-52151116 AAGCCAGGAGGGCCAGGGCATGG + Intergenic
1096581460 12:52588126-52588148 AGGCCAGGAGGGAGAGGGCAGGG - Intronic
1102436634 12:112929293-112929315 AAGCCAGCTGGATTGAGGCAAGG + Intronic
1102565865 12:113797149-113797171 AAGGCAGCAGGGATACGGTGGGG + Intergenic
1103186710 12:118964329-118964351 AAACCAGCAAGAAGAAGGCAGGG - Intergenic
1104293739 12:127493007-127493029 AAGCCAGCAGAGCTATGCCATGG - Intergenic
1104344284 12:127981880-127981902 ATTCAAACAGGGATAAGGCAGGG + Intergenic
1104731973 12:131112083-131112105 AAGCAAGCAAGGAGAAGCCATGG - Intronic
1104977378 12:132558179-132558201 GAGCCCTCAGGGATAAGTCAGGG - Intronic
1107293731 13:38887874-38887896 AAGGCAGGAGTCATAAGGCAGGG + Intergenic
1107646186 13:42496547-42496569 AAGCCAGCAGGGACAAGGCGTGG - Intergenic
1108901471 13:55414084-55414106 CAGTCAGCATGGAAAAGGCATGG + Intergenic
1112272138 13:97977296-97977318 AAGGCAGTAGGGACAAGGCAGGG - Intronic
1112339943 13:98544517-98544539 CAGCCAGCCGGCAGAAGGCAGGG + Intronic
1112564497 13:100541490-100541512 GAGGGAGCAGGGATAAGGAAGGG - Intronic
1114522117 14:23346477-23346499 AAAGCAGCAGGGAGGAGGCAGGG + Exonic
1114901574 14:27067088-27067110 AAGGCTGCAAGGATAGGGCAGGG - Intergenic
1116045440 14:39737237-39737259 AAGCCAGAAGAGACAAGGAATGG - Intergenic
1116345375 14:43786458-43786480 AAGCCAGAAGGGAGATGGAATGG + Intergenic
1117008088 14:51442947-51442969 AAGCATGCAGGCATAAGGCCAGG - Intergenic
1117745603 14:58866382-58866404 TTCCCAGCAGGGAGAAGGCATGG - Intergenic
1118003823 14:61547663-61547685 AAGACAGCAGGCATCAGCCATGG - Intronic
1119579444 14:75763861-75763883 AAGGCAGCAGAGATAGGACAAGG - Intronic
1120713566 14:87817450-87817472 AAATCAGCAGGGGCAAGGCAGGG + Intergenic
1121089776 14:91173298-91173320 AAGCCAGCATGGGTAACACAAGG - Exonic
1122774190 14:104110038-104110060 AAGTCACCAGGCACAAGGCATGG - Intronic
1124686082 15:31783078-31783100 AAACCAGCAAGGAGAAGGGAAGG + Intronic
1125135747 15:36340406-36340428 AAGTTAGCAGGGATAAGGAAGGG - Intergenic
1125535191 15:40438355-40438377 AAGCCAGCAAAGAATAGGCAGGG - Intergenic
1126551073 15:49930134-49930156 AAGCAAGGAGGGATAAGGAATGG + Intronic
1127661383 15:61103159-61103181 AAGCAACCATGGAGAAGGCATGG + Intronic
1128927191 15:71668450-71668472 AAGACAGCAGGTAAAAGGGAGGG + Intronic
1129296403 15:74602575-74602597 CAGGCAGCAGGGATCGGGCATGG + Intronic
1131290378 15:91101637-91101659 AAGCCCTCATGGATTAGGCATGG + Intronic
1132328532 15:100993829-100993851 AAACCAGCAGGAATAAGGGAAGG - Intronic
1132585011 16:702292-702314 GAGCTTGCAGGGCTAAGGCAGGG - Intronic
1134820937 16:17246901-17246923 ACCCCAGCAGGGAACAGGCAAGG + Intronic
1135393998 16:22117092-22117114 CAGCCTGCAGGGATGAGGCCAGG - Exonic
1138251599 16:55505896-55505918 CAGCCAGCAGTGAAAAGCCAGGG - Exonic
1138955199 16:61963182-61963204 AAGCAAGGAATGATAAGGCATGG + Intronic
1139123115 16:64043943-64043965 AAGCCAGCAGGGACAAATCCTGG + Intergenic
1139530203 16:67538906-67538928 CAGACAGCAGGGAGAGGGCATGG - Intronic
1139937170 16:70579827-70579849 AAGCCAGCAGGGGCGGGGCAGGG - Intergenic
1140341341 16:74166772-74166794 ACACCAGCAGGGAGAAGACAAGG + Intergenic
1140925487 16:79578973-79578995 AAGCCAGCCAGGAAAAGACATGG + Intergenic
1141980734 16:87548313-87548335 AAGGCACCAGGGAGAGGGCAGGG + Intergenic
1142411411 16:89918960-89918982 CAGCCACCAGGGAAGAGGCAGGG + Exonic
1143191363 17:5042459-5042481 AAGCCAGAAGGAATAAGATAAGG - Intronic
1144029196 17:11304487-11304509 AAGCCAGCAGAGAGAAGCAAAGG + Intronic
1146017712 17:29247128-29247150 AAACGAGCAGGGAGAAGGTATGG + Intronic
1146258926 17:31409117-31409139 GAGCCAGTAGGGATAAGGGTTGG + Intronic
1146558734 17:33849741-33849763 AAGCAAGCAGGACTCAGGCATGG + Intronic
1147004628 17:37392541-37392563 ATGTCAGGAGGGATAAGACAGGG + Exonic
1147343058 17:39766691-39766713 AAGCCAGCAGGCAGAAGAGAGGG + Intronic
1147690702 17:42312862-42312884 CAGCCAGCGGTGATAATGCAGGG - Intergenic
1148674054 17:49434835-49434857 TAGCCAGAAGGGATGAGGCGGGG + Intronic
1148730518 17:49832676-49832698 ATGGCAGCAGGGAGAAGGCCTGG + Exonic
1148882259 17:50738282-50738304 AAGTTAGTAGGGATTAGGCAGGG - Intronic
1149172214 17:53824333-53824355 AAGTCAGGACGGATAATGCATGG + Exonic
1150718186 17:67590178-67590200 AAATCAACAGGGATTAGGCAGGG + Intronic
1151560318 17:74866356-74866378 AAGGCAGCAGGGGTGAGGCCAGG - Intronic
1153799116 18:8653422-8653444 AAGGCATAAGGGATAAGCCAGGG + Intergenic
1153834136 18:8949258-8949280 AAGGCAGCAGGGGTGGGGCAGGG + Intergenic
1154282962 18:13024243-13024265 AAGTTATCAGAGATAAGGCAGGG - Intronic
1155776935 18:29776551-29776573 ATGCCAGAAGGGAGAAGGCAGGG - Intergenic
1156494725 18:37518186-37518208 CAGCCAGCAGTGAGAAGCCAGGG - Intronic
1156539958 18:37899806-37899828 AAGCCAGCAGGTATGTGGCTGGG + Intergenic
1156887887 18:42156635-42156657 AAGAGAGCAGGAATAAGGCAGGG - Intergenic
1157230122 18:45907741-45907763 AAGCCTTCAGGTAGAAGGCACGG + Intronic
1159066174 18:63569888-63569910 TAGTCAGCAGGGACCAGGCACGG - Intergenic
1160092495 18:75840276-75840298 AGGCCAGAAGAGAGAAGGCAGGG - Intergenic
1161160880 19:2761351-2761373 AAGCCAGCAGTGCCAAGGCAAGG + Intronic
1161872086 19:6878076-6878098 AAGCCAGAAAGGACAAGGAATGG + Intergenic
1161935434 19:7368936-7368958 GAGTCAGCAGGGAGAAGGGAGGG + Intronic
1162211188 19:9093516-9093538 CAGGCAGCAGGGATAAGAGATGG - Exonic
1162371691 19:10283800-10283822 AAGCCAGCAGGGAGAAGGTGGGG + Intronic
1162764284 19:12908906-12908928 GGGCCAGCAGGGAGGAGGCATGG - Intronic
1164200402 19:23013270-23013292 AAGGCAGCAGGGATCAGAAAGGG + Intergenic
1164435071 19:28221979-28222001 AAGCCACCAGTGAGGAGGCAGGG - Intergenic
1166594516 19:44033792-44033814 AAGCCAGTAAGGATTAGGAAAGG + Intergenic
1168493585 19:56832262-56832284 AACCCAGCAGAGAAAGGGCAGGG - Intronic
925005321 2:438885-438907 AATCCAGCAGGGAGAACCCAAGG - Intergenic
925409961 2:3634245-3634267 AAGGCAGCCAGGATAGGGCAGGG + Intronic
925585655 2:5461525-5461547 AAGCCACCTGGGAACAGGCAAGG + Intergenic
928765697 2:34642525-34642547 AGGCAAGCAGGGATAGGGAAGGG + Intergenic
932758829 2:74426441-74426463 AGGCGAGCAGGGGTTAGGCAGGG + Exonic
933278880 2:80310549-80310571 AAGACAGCAGGGACAAGTGAGGG + Intronic
934604248 2:95682288-95682310 CAGGCAGCAGGGATAAGGATGGG + Intergenic
934942648 2:98513759-98513781 GGGGCAGCAGGGACAAGGCAAGG - Intronic
935303687 2:101716614-101716636 AAGCCAGCAAGTTTCAGGCATGG - Intronic
936011928 2:108930461-108930483 TGGCCAGCAGGGGTGAGGCAGGG - Intronic
936278431 2:111119577-111119599 CAGCCGGCAGGGAGAAGGAAGGG - Intronic
936537643 2:113324513-113324535 CAGGCAGCAGGGATAAGGATGGG + Intergenic
942397265 2:175564106-175564128 AACCCATCAGGGATAAGTAAAGG - Intergenic
943210056 2:184951628-184951650 CAGCCAGCAGGGGTATAGCATGG - Intergenic
944479050 2:200136261-200136283 AGGCCCTCAGAGATAAGGCAAGG + Intergenic
944891385 2:204120638-204120660 AAGCAAGAAGGGAGAAGGGATGG - Intergenic
945493947 2:210487253-210487275 AAGCCAACAGGGAAGAAGCAGGG - Intronic
946433826 2:219639463-219639485 AAGCCTGCAGGGAGAAGGTGGGG - Exonic
946927733 2:224642497-224642519 GAGTCATCAGGGATGAGGCAGGG + Intergenic
947711872 2:232321147-232321169 AAGTGAGCAGGGCTGAGGCAAGG + Intronic
947820915 2:233068878-233068900 AAGCCAGCAGGAGGAAGGGATGG + Intronic
948220054 2:236262461-236262483 AACCCAGCAGCGATCTGGCAGGG + Intronic
948625768 2:239266942-239266964 AAGCCACAGGGGACAAGGCAGGG + Intronic
948687314 2:239677409-239677431 GACGCAGCAGGGACAAGGCAGGG - Intergenic
949041571 2:241852148-241852170 CCGCCAGCAGGGTTAGGGCAGGG + Intronic
1169087452 20:2836172-2836194 AAGCGGGTAGGGAAAAGGCATGG + Exonic
1169149710 20:3279785-3279807 GAGGCAGCAGGGCTAAGGCAGGG + Intronic
1169209821 20:3759685-3759707 AGTCCAGAAGGGATAAGGGAGGG - Intronic
1169248415 20:4042036-4042058 GAGCCAGCAGGGATGGGGCTGGG + Intergenic
1172847033 20:37935638-37935660 CAGCCAGCAGGGAAATGGGAGGG - Intronic
1173530102 20:43762698-43762720 AAGGCAGCAAGGAGAAGGCCAGG - Intergenic
1173726978 20:45305061-45305083 AAGCCTGCAGGGACCAGGCAGGG + Intronic
1174056534 20:47802217-47802239 AAGTCAGCAGGGCAGAGGCAGGG - Intergenic
1174238876 20:49116879-49116901 AGGCCAGCAGGGAAAAGGAAGGG + Intronic
1175675271 20:60941315-60941337 ATGCCAACAGGGAAAATGCATGG - Intergenic
1179913216 21:44461001-44461023 AAACCAGCAGGGAGAGGGCCCGG - Exonic
1180568264 22:16693872-16693894 AAGACAGCAGAGAAAAGACAGGG + Intergenic
1181427841 22:22855792-22855814 AAGGCAGGAGGGACAGGGCAGGG + Intronic
1181468524 22:23123800-23123822 TAGGCAGCAGGGCTGAGGCAAGG + Exonic
1182997408 22:34826802-34826824 AGGCCAGTAGGGAAAAGGAAAGG - Intergenic
1184402765 22:44283352-44283374 AAGCCTGCAGGGATTGTGCACGG - Intronic
949313687 3:2728525-2728547 AAGTCACCAGGGAAAAGGAAGGG - Intronic
950271598 3:11620404-11620426 GAGCCAGCAGGGTGAGGGCAAGG + Intronic
950465053 3:13148716-13148738 AAGCCTGCAGGGGCCAGGCATGG - Intergenic
950622588 3:14217660-14217682 AGGCCTGAAGGGATAAGGCCAGG - Intergenic
950687323 3:14627880-14627902 AAGCAGGCAGGGTAAAGGCAGGG - Intergenic
953201604 3:40782806-40782828 AAGCCACCAGGGATCATGAAGGG + Intergenic
953237635 3:41120244-41120266 AAGCCCGCAGGGATAAGCGGAGG - Intergenic
953415791 3:42715831-42715853 AAGGCAGAAGGGAAATGGCATGG - Intronic
953929777 3:47000111-47000133 AAGCCATCAGGGTCAGGGCAGGG - Exonic
956171112 3:66433842-66433864 ACCCCAGCATGGACAAGGCACGG - Intronic
957244601 3:77701675-77701697 AATACAGCAGGGATAGTGCAGGG + Intergenic
962264394 3:133935010-133935032 AAGCAGGCAGGGAGTAGGCATGG + Intronic
962627693 3:137242991-137243013 AAGAAAGCAGGAATAAGGGAGGG - Intergenic
962853430 3:139324832-139324854 AGGCCAGCAGGGCTAAGGGATGG + Intronic
964895163 3:161587348-161587370 AAGCCAACAGAGACAAGGCAGGG - Intergenic
965917134 3:173863281-173863303 AAGACAGCAGGTATATGTCATGG - Intronic
967494483 3:190127639-190127661 GAGCCAGAAGGAGTAAGGCAAGG - Intergenic
967869915 3:194221414-194221436 AAGCAAGCAGGGGCAAGGCGAGG - Intergenic
968103832 3:195987194-195987216 AAGCCAGCAGCAACCAGGCAGGG - Intergenic
968302133 3:197624787-197624809 AAGCCAGCAGCAACCAGGCAGGG - Intergenic
969541331 4:7791497-7791519 AATCCAGCAGGTATTAGGTAGGG - Intronic
969868834 4:10092536-10092558 AACCCAGCAGGGGCAAGGGAGGG + Intronic
971219038 4:24688234-24688256 CAGCCATCAGGGAAGAGGCAAGG - Intergenic
971234639 4:24829911-24829933 AAGGCAGCAGGGTTTAGGAAAGG + Intronic
971341387 4:25772586-25772608 AAGGCAGAAGGGAAAAGGAAAGG + Intronic
972229563 4:37055626-37055648 AAGCCAGCAGGGTAAAGTGATGG + Intergenic
973692316 4:53449626-53449648 CAGCCAGGTGGGATAAGTCAGGG + Intronic
975980806 4:80157166-80157188 GAGCCATCAGGGAAGAGGCAAGG - Intergenic
976246253 4:83008952-83008974 GAGTCAGCAGCTATAAGGCATGG + Intronic
979363188 4:119788708-119788730 AAGGCAGCAAAGAAAAGGCAAGG + Intergenic
980100833 4:128539784-128539806 AAGCCAGGATGGCTAAGGCTTGG + Intergenic
981652625 4:147076799-147076821 AAGACAGCAGTGATGAGGGAGGG - Intergenic
981726231 4:147850310-147850332 AAGCCAGCAGGGGCAATGCTTGG + Intronic
982890773 4:160847193-160847215 ATGCCAGCTGGGCAAAGGCAAGG - Intergenic
982974836 4:162042521-162042543 AAGATAGCATGGATAAGGGATGG + Intronic
984622296 4:181967543-181967565 AAGCCAGCATGGGAAAGTCAGGG - Intergenic
984816762 4:183845331-183845353 AAGCCAGGTGGGATATGGCATGG + Intergenic
986103156 5:4632274-4632296 AAGCCTGCAGGGGTAGGGGAAGG + Intergenic
986603372 5:9496615-9496637 AACCCAGCTGGGATGTGGCAGGG + Intronic
987296713 5:16559319-16559341 GAGCCAGCAGGGATTAGCAAAGG - Intronic
989677673 5:43990868-43990890 AAGCCAACAAGGATAATACATGG - Intergenic
990096832 5:52125444-52125466 AAGTTATCAGGGATAAGGAACGG + Intergenic
992230351 5:74657466-74657488 AATCCAGCAGGGTGAAGGGATGG - Intronic
993909073 5:93658924-93658946 AAGCAAACAGGGATAGGGTATGG + Intronic
994255381 5:97587301-97587323 AAGCAAACAGTGATGAGGCAAGG + Intergenic
996423083 5:123283857-123283879 TAGCCAACAGAGATAAGGGAGGG + Intergenic
997179772 5:131815872-131815894 AAGGCAGAAGGAATATGGCATGG + Intronic
997411742 5:133696145-133696167 AAGCCTGCAGGGAGAACGCAGGG + Intergenic
998737883 5:145163834-145163856 AAGCCATAATGGAGAAGGCAGGG + Intergenic
999907214 5:156154962-156154984 ATGTCTGCAGGGATGAGGCAGGG + Intronic
1002077836 5:176719781-176719803 CAGCCAGAAGGCATAAGACAAGG - Intergenic
1002767028 6:250271-250293 AAGCCAGCTGGGATAATGATAGG + Intergenic
1002771016 6:291364-291386 AAGTCAGCAGGGGTGAGCCAGGG + Intergenic
1002805858 6:573376-573398 GAGGCAGCAGGGCGAAGGCATGG - Intronic
1004363288 6:14990068-14990090 AAACTAGCAGAGATAGGGCAGGG - Intergenic
1005008040 6:21309812-21309834 AAGGCAGCGGGGAGAGGGCAGGG - Intergenic
1006045049 6:31288050-31288072 AACACAGCTGGGGTAAGGCAGGG + Intronic
1006149714 6:31980414-31980436 AAGCCAGCAGAGATGAGGGCTGG - Intronic
1006239913 6:32668613-32668635 AATGCAGCAGGGATAGGGCCAGG - Intergenic
1006500866 6:34458020-34458042 GAGCCTGCAGGGACAGGGCAAGG - Intergenic
1006813348 6:36835078-36835100 AAGCCAGCAGGGCTAAGCAATGG + Intronic
1006909675 6:37555779-37555801 AAGCCAGCAGGGGTGTGGAACGG + Intergenic
1007716875 6:43861847-43861869 GAGGGAGCAGGGATAGGGCAGGG + Intergenic
1008803934 6:55404979-55405001 AAGCCTGCAGGGAGAAGGCCTGG - Intergenic
1010154455 6:72776856-72776878 AAGCCAGCAGACATGAGGCCAGG + Intronic
1010524338 6:76881854-76881876 AATCCAAAAAGGATAAGGCATGG - Intergenic
1011227722 6:85126514-85126536 GAGCCAGCAGGAGCAAGGCATGG - Intergenic
1012090408 6:94887293-94887315 AAGCTATCAGGGATAAAGAAGGG - Intergenic
1013119164 6:107126077-107126099 ATGCCTGCAGGGAGCAGGCAAGG + Intergenic
1013544140 6:111139052-111139074 AAGCCAGCAGGGAGAAGGAAAGG - Intronic
1018004143 6:159604594-159604616 ATGCCAGTAGGGAGAAGGCAAGG - Intergenic
1018790992 6:167147522-167147544 ATGCCTGCAGGGACGAGGCAGGG + Intronic
1019978529 7:4604357-4604379 GAGCCTGCAGGGAAAAGGCAAGG - Intergenic
1020098774 7:5382758-5382780 AGGCCTGCAGGGATGAGGCAAGG - Intronic
1020369190 7:7414204-7414226 AAGTCAGAAGGGAGAAGGAATGG - Intronic
1021421750 7:20453468-20453490 AAGCAAACTGAGATAAGGCAGGG - Intergenic
1021725878 7:23547781-23547803 AAGCAAGCAGGCAGAAAGCAAGG - Intergenic
1022036070 7:26535928-26535950 GAGCCATCAGGGACAAGGCAAGG + Exonic
1022073376 7:26940186-26940208 CAGCCAGCAGGTAGAAGGAAGGG - Intronic
1023093376 7:36636939-36636961 TAGCCAGCAGGGAGAAGCCAAGG + Intronic
1024797591 7:53036757-53036779 GGGCCAGCAGGGCGAAGGCAAGG - Exonic
1025236460 7:57237943-57237965 AAGTCAGCAGGGCAGAGGCAGGG + Intergenic
1029133847 7:98354622-98354644 AAGCAACCAGGGAAGAGGCAAGG + Intronic
1029418766 7:100460999-100461021 AAGTCAGCTGGTAGAAGGCAGGG - Intronic
1029843424 7:103389512-103389534 AAGTGAGTAGGGAGAAGGCATGG - Intronic
1030542182 7:110844746-110844768 AAGACAGCATGGAAATGGCAAGG + Intronic
1031967203 7:128035073-128035095 AAGCCAGCAGTGATTGGGGAAGG + Intronic
1032927160 7:136620288-136620310 AAGCTAGCATGGAGCAGGCAGGG - Intergenic
1033320122 7:140331821-140331843 AAGCCAGTAGGGAAAAGAAAAGG + Intronic
1036795849 8:11756269-11756291 CTGCCAGAAGGGATAAGCCATGG - Intronic
1037061439 8:14515086-14515108 AAGCAAGGAGGGATGAGGAAAGG - Intronic
1038862557 8:31403234-31403256 AAGCCAGCAGCCATCAGGGATGG + Intergenic
1041712905 8:60909925-60909947 AAGCGAGGAGGGAGAAGTCAAGG - Intergenic
1041803854 8:61828665-61828687 AACCCACCATGGATAAGGAAAGG - Intergenic
1042273186 8:66976533-66976555 AGGCCAGAGGGAATAAGGCAAGG - Intronic
1043603032 8:81963765-81963787 AATCCAGCAGGGATAAAACAGGG + Intergenic
1044157403 8:88864577-88864599 AAACCTGCAGAGATAAGACAAGG + Intergenic
1044249599 8:89990442-89990464 AAGAAGGCAAGGATAAGGCATGG - Intronic
1046857984 8:119056542-119056564 AAGCCAGAAGGGAGAAGTCATGG + Intronic
1047165721 8:122436264-122436286 AAGCCACCAGGGAAATGGAAAGG + Intergenic
1047732780 8:127739882-127739904 AAGACAGCTGGGTTATGGCATGG - Intronic
1049198510 8:141328498-141328520 AAGCCAGCGGGGCTGAGGCAGGG + Intergenic
1049551641 8:143262646-143262668 AAGCCAGCAAGCAGTAGGCAAGG - Intronic
1051616654 9:19013218-19013240 AAGGCATAAGGCATAAGGCATGG + Intronic
1052104713 9:24498811-24498833 GTGCCAGCAGGGAGAAAGCAAGG - Intergenic
1055469356 9:76595864-76595886 AACCCAGGAGGGATATGACAGGG - Intergenic
1056198678 9:84253425-84253447 GAGATAGAAGGGATAAGGCATGG - Intergenic
1056273948 9:84974792-84974814 AAGCCAGCAGGGATAAGGCAAGG - Intronic
1056406453 9:86280658-86280680 AAGACATCAGGGACCAGGCATGG + Intronic
1056831990 9:89924683-89924705 AAGACAGCAGGGATAACCAAGGG + Intergenic
1058463743 9:105208055-105208077 AAGCCAGCAGGGCTCAGACTTGG + Intergenic
1059110237 9:111550882-111550904 AAGGAAACAGGGATAATGCAGGG - Intronic
1059326346 9:113506179-113506201 AGGCAAGCAGGGAGAAGGGAAGG + Intronic
1059755978 9:117293727-117293749 CAGCCAGCTGGGCCAAGGCAAGG + Intronic
1060402388 9:123356332-123356354 CAGCCAGGAGGGAAAGGGCAGGG - Exonic
1061178762 9:129012128-129012150 AAGCCAGCTTGGGTAAGGCGGGG - Intronic
1061337079 9:129946781-129946803 GAGCCAACAGTCATAAGGCAAGG + Intronic
1061866087 9:133492440-133492462 AAGCCAGCCTGGACAAAGCAGGG - Intergenic
1061909048 9:133713192-133713214 AAGAGAGCAGTGATCAGGCAGGG + Intronic
1062138120 9:134940378-134940400 AAGCCAGCAGGCCTCAGCCATGG - Intergenic
1185676952 X:1856965-1856987 AAGACAGGAGGGAGAAGGCAGGG - Intergenic
1187462701 X:19502129-19502151 AAGCCAACAGGGAGAAGGAGGGG + Intronic
1188498827 X:30804567-30804589 AAGGCACAAGGCATAAGGCAAGG - Intergenic
1191713361 X:64176241-64176263 AAGCCTTCAGGGTTAAGACAAGG + Intergenic
1192207312 X:69105081-69105103 AAGCCAGGATGGGGAAGGCAAGG + Intergenic
1193554292 X:82933523-82933545 AAGCCAGGTGTGAAAAGGCAAGG - Intergenic
1197406154 X:126053717-126053739 AAACATGCAGGGATGAGGCAAGG + Intergenic
1199003246 X:142665209-142665231 AGGCCAGCAGGGATATGAGAAGG - Intergenic
1199843654 X:151675324-151675346 AAGGCAGTAGGGATAAGCCAGGG - Intronic
1201597942 Y:15693164-15693186 AATCCACCATGGATAAGACAAGG - Intergenic