ID: 1056273949

View in Genome Browser
Species Human (GRCh38)
Location 9:84974797-84974819
Sequence AGCTGAAGCCAGCAGGGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 287}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056273949_1056273955 7 Left 1056273949 9:84974797-84974819 CCTTATCCCTGCTGGCTTCAGCT 0: 1
1: 0
2: 5
3: 26
4: 287
Right 1056273955 9:84974827-84974849 AGCAGCCTCAAGGAAGTCGCCGG No data
1056273949_1056273958 16 Left 1056273949 9:84974797-84974819 CCTTATCCCTGCTGGCTTCAGCT 0: 1
1: 0
2: 5
3: 26
4: 287
Right 1056273958 9:84974836-84974858 AAGGAAGTCGCCGGCTGTTTGGG No data
1056273949_1056273952 -3 Left 1056273949 9:84974797-84974819 CCTTATCCCTGCTGGCTTCAGCT 0: 1
1: 0
2: 5
3: 26
4: 287
Right 1056273952 9:84974817-84974839 GCTTTCCCTAAGCAGCCTCAAGG No data
1056273949_1056273960 25 Left 1056273949 9:84974797-84974819 CCTTATCCCTGCTGGCTTCAGCT 0: 1
1: 0
2: 5
3: 26
4: 287
Right 1056273960 9:84974845-84974867 GCCGGCTGTTTGGGAGTTAAGGG No data
1056273949_1056273959 24 Left 1056273949 9:84974797-84974819 CCTTATCCCTGCTGGCTTCAGCT 0: 1
1: 0
2: 5
3: 26
4: 287
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data
1056273949_1056273957 15 Left 1056273949 9:84974797-84974819 CCTTATCCCTGCTGGCTTCAGCT 0: 1
1: 0
2: 5
3: 26
4: 287
Right 1056273957 9:84974835-84974857 CAAGGAAGTCGCCGGCTGTTTGG No data
1056273949_1056273962 26 Left 1056273949 9:84974797-84974819 CCTTATCCCTGCTGGCTTCAGCT 0: 1
1: 0
2: 5
3: 26
4: 287
Right 1056273962 9:84974846-84974868 CCGGCTGTTTGGGAGTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056273949 Original CRISPR AGCTGAAGCCAGCAGGGATA AGG (reversed) Intronic
900073574 1:793483-793505 AGCTGAAGAGAACAGGGAGAGGG - Intergenic
900785667 1:4648499-4648521 AGCAGAAGCCACAAGGGCTATGG + Intergenic
901433243 1:9231006-9231028 AGCTGAAGCCAGCAAGGAAACGG + Intergenic
901470720 1:9454525-9454547 AGATGATGCCACCAGGGACAGGG - Intergenic
903681338 1:25099283-25099305 AGCTGAGGCCAGCAGGGACAAGG + Intergenic
904436879 1:30504824-30504846 AACTGCAGCCAGCAAGGCTATGG + Intergenic
906205956 1:43986490-43986512 AGAGGAAGCCAGCCTGGATAAGG + Intronic
906635535 1:47407762-47407784 AGGTGGAGCCACCAGGGAGAGGG - Intergenic
907484683 1:54769008-54769030 AGTGGAGGCCAGCAGGGATCAGG + Intergenic
907708012 1:56849440-56849462 AGATGAAGCCAGCCTGGCTATGG + Intergenic
909687008 1:78361208-78361230 AGATGAAGGCAGCAGGCTTAAGG - Intronic
910458914 1:87427136-87427158 AGCTGCAGCAAGCAGGGCTGAGG - Intergenic
910466339 1:87504294-87504316 AGCTGAAGCAATCAGGCAGAAGG + Intergenic
912034904 1:105300855-105300877 AGCTGAAGCCAGCACAGCAATGG + Intergenic
912586375 1:110770632-110770654 AGCAGAAGCCAGCTGAGATGAGG + Intergenic
913389826 1:118298310-118298332 AGCTGGAGCAAGAAGGGAGAAGG + Intergenic
914316196 1:146514035-146514057 AGCTGCAGCAAGCAGGGCTGAGG - Intergenic
914418027 1:147502618-147502640 AACTGAAGCCACCAGGGCTTTGG + Intergenic
914498159 1:148219326-148219348 AGCTGCAGCAAGCAGGGCTGAGG + Intergenic
914506198 1:148291206-148291228 AGCTGAAGCAATCAGGCAGAAGG + Intergenic
914760809 1:150596553-150596575 AAGTGAAGCCAGAAAGGATATGG + Intergenic
915511858 1:156390942-156390964 AGCTGAGGCCAGCAGGGCCAGGG - Intergenic
915531506 1:156504945-156504967 AGCTGAAGCGGGCAGGGAGGGGG + Intergenic
915904932 1:159870847-159870869 AGCTGATGCCTGCAGGGACCAGG - Intronic
917094998 1:171391088-171391110 AGGTGAAGCCAGCTGGGTTCTGG - Intergenic
917160331 1:172050167-172050189 AGGTGAGGGCAGCAGGGATGAGG - Intronic
918358104 1:183724867-183724889 ACCTGAAGCCAGCAGAGCTCTGG - Intronic
919539118 1:198827483-198827505 TGGTGAAGCCAGAAGGGAGATGG + Intergenic
919723428 1:200865425-200865447 AGCTGGTGGCAGCAGGGATGAGG - Intergenic
919770198 1:201153851-201153873 AGCTGAAGCCAACAAGGTGAGGG - Exonic
920040074 1:203089882-203089904 TGCCCAAGCCAGCAGGGATGGGG - Intergenic
920052913 1:203174347-203174369 AACTGAGGCCAGCAGGTAGAGGG - Intronic
922999654 1:229996529-229996551 AGCTGGAGGCAGGAGGGATGAGG - Intergenic
923047818 1:230368382-230368404 AGAGGAAGTCAGCAGGGATTGGG + Intronic
923417197 1:233775019-233775041 AGCAGAAGACAGTAGGCATAGGG + Intergenic
1063460506 10:6212402-6212424 AGCGGAAGCCAGGAGGGAGCTGG + Intronic
1064218819 10:13422050-13422072 TGCAGAAGCCAGGAGGGTTAGGG - Intergenic
1065047184 10:21754839-21754861 AGCCTCAGCCAGCAGGGACAGGG - Intergenic
1065971460 10:30809353-30809375 AACTGAAGCCTGCAAGGAAAGGG - Intergenic
1067323196 10:45241667-45241689 AACTGAGTCCAGCAGGGGTAGGG - Intergenic
1068735337 10:60408004-60408026 AGCAGATGGCAGCAGGGGTAGGG - Intronic
1069430816 10:68332474-68332496 AGGCCAAGCCAGCAGGGAAAGGG - Intronic
1071408675 10:85364169-85364191 AACTGAAGCCATCAGGCAGAGGG + Intergenic
1071510259 10:86257039-86257061 AGAGGAACCCAGCAGGGACAGGG - Intronic
1074417193 10:113277206-113277228 AGCTGAAGCTACCAGTGCTAGGG - Intergenic
1074873442 10:117595711-117595733 TGCTGAGGCCAGGAGGGATTGGG + Intergenic
1076121380 10:127939692-127939714 AGCTGAGCCCAGCAGGGGCAGGG + Intronic
1076584067 10:131533408-131533430 ATCCGAAGCCAGAAGGGACAGGG + Intergenic
1077350602 11:2091457-2091479 AGGCGAAGCCAGCTGGGAAAAGG - Intergenic
1079291477 11:19191964-19191986 ATCTGAAGCCAGGATGGATTTGG - Intronic
1083424736 11:62577373-62577395 AACTGGAGCCAGCTGGAATAAGG + Intronic
1083977536 11:66135630-66135652 AGAGGAGGCCAGCAGGGATGAGG - Intronic
1084091393 11:66881430-66881452 AGCTGAAGCTGGGAGGGAAATGG - Intronic
1085038376 11:73312863-73312885 AGCTGAAGCCAGAAGGTAGAAGG - Intronic
1085277529 11:75309578-75309600 AGCTGAAGCCAAGATGGACAAGG - Intronic
1085341318 11:75733367-75733389 GGCTGAAGCCACCATGGATAAGG - Intergenic
1088789159 11:113208954-113208976 AGATGAAGTGAGCAGGGATGTGG - Intronic
1089223390 11:116894630-116894652 AACTGAAGCCAGGAGAGATTAGG - Intronic
1089779369 11:120862303-120862325 AGCTGTAGACAGCAGGGAGGGGG + Intronic
1089846433 11:121462304-121462326 AGCAGAAGCCAGGAAGGAGAAGG - Intronic
1089911603 11:122106064-122106086 AGTTGAAGCCAGCAGAGAGCAGG + Intergenic
1090203921 11:124874743-124874765 AGCAGAGGCCACCAGGGACAGGG - Intronic
1091364446 11:135005976-135005998 AGCTCAAGCCTGCAGAGATCTGG - Intergenic
1093824382 12:23665459-23665481 AGCTGAAGCCTGGAGGGAGGAGG + Exonic
1095747275 12:45673833-45673855 AGCATAAACCAGGAGGGATATGG - Intergenic
1095956930 12:47812236-47812258 AGCTGTAGCCAGAAGTCATAGGG - Intronic
1097070914 12:56354327-56354349 AGCTGCAGTCAGCAGGGAGCAGG + Intronic
1098034146 12:66284868-66284890 GGATGGAGCCAGCAGGGATAAGG + Intergenic
1098705700 12:73685693-73685715 ACCTGAAGCCAGCAGAGAAGTGG - Intergenic
1101314522 12:103616934-103616956 AGCTGAATCAAGCAGGGACCAGG - Intronic
1102794327 12:115675422-115675444 AGCTGATGCCAGGAGAGCTAAGG - Intergenic
1102922597 12:116803443-116803465 ATCTGAAGCAAGCATGGAAAAGG - Intronic
1104350289 12:128039314-128039336 GACTGAAGCCAGCAGAGAAAAGG + Intergenic
1104406762 12:128524416-128524438 GGCTAAAGCCAGCAGGGGAAGGG - Intronic
1106296467 13:28418453-28418475 AGCTGAAGTCTGCAGGGAATAGG - Intronic
1106431979 13:29689327-29689349 AGATGAAGACAGCCGGGAGAAGG + Intergenic
1107025252 13:35795141-35795163 AGCTGACGTCATGAGGGATATGG + Intronic
1107171925 13:37353159-37353181 GGCTGGAGCCAGAGGGGATAGGG - Intergenic
1107646187 13:42496552-42496574 GGGAGAAGCCAGCAGGGACAAGG - Intergenic
1108738870 13:53314114-53314136 AGCTGAGGCCAGGAGGTAGAAGG + Intergenic
1109268377 13:60226817-60226839 AGCTGAAGGCAGAATGCATAGGG + Intergenic
1112053705 13:95670673-95670695 ACCTGAAGCCAGCACAGCTATGG + Intergenic
1112407196 13:99131546-99131568 AGCTGAAGAGAGCATGGAAATGG + Intergenic
1116926674 14:50645819-50645841 AGCTTAAGGTAGCAGGGTTAAGG + Intronic
1117496764 14:56313010-56313032 ATCTGAAGCTAGCTGGGAAAAGG + Intergenic
1117707425 14:58485756-58485778 AGATGAAGACAGCAGGGAGATGG - Intronic
1119185744 14:72641200-72641222 TGCTGAAGCCATCAGTGATTTGG - Intronic
1120034308 14:79678924-79678946 ATCTGAACCAAGCAGGGAAACGG - Intronic
1120036513 14:79704452-79704474 AGCTGGTGGCAGCAGGGAAAAGG - Intronic
1122151673 14:99729241-99729263 AGCCCAGGCCTGCAGGGATAGGG - Intergenic
1122307337 14:100774055-100774077 TGCTGAAGCCGGCAGGGAGAAGG - Intergenic
1123978571 15:25577251-25577273 AACTGAAGGCACCAGGGAAACGG - Intergenic
1124203125 15:27695406-27695428 AGCTGAAGGCTGCAGGGAGGAGG + Intergenic
1125518888 15:40337536-40337558 AATTGAAGGCAGCAGGGAGATGG + Intronic
1127850078 15:62904630-62904652 TGCTGCAGCCACCAAGGATAGGG - Intergenic
1128099614 15:64988272-64988294 TGTTGAAGCCATGAGGGATAGGG - Intronic
1128342414 15:66831733-66831755 AGCAGAAGCAAGCAGGCATCAGG + Intergenic
1128674717 15:69600152-69600174 AGCTGAGGGCAGCAGGCAGAGGG + Intergenic
1128881065 15:71243168-71243190 TGATGAAGACAGCAAGGATATGG + Intronic
1129236352 15:74225926-74225948 AGCTGAGGCCAGCAGGTACCAGG + Intergenic
1129252172 15:74315072-74315094 ACCTGGAGCCAGCAGGGGTAAGG + Intronic
1129811516 15:78514657-78514679 AGCTAAGGCCAGCAGAGTTAGGG + Intronic
1130412031 15:83655071-83655093 AGCTGAAACCAGGAGGGAAGCGG - Intronic
1130654751 15:85784670-85784692 GGCTGCAGCCAGCAAGGAAATGG + Intronic
1130796976 15:87220028-87220050 ATCTGAAGCCAGAAGGTGTAAGG + Intergenic
1131079471 15:89522785-89522807 AACTGAAGCCAGAAGGAAAAAGG + Intergenic
1131509755 15:93043601-93043623 AACTAAAACCAGCAGGGAGAGGG + Intronic
1132904786 16:2276994-2277016 AGCAGGAGCCAGCGGGGATGGGG + Intronic
1133542493 16:6769957-6769979 ACCTGTAGCCTGCAGGCATAAGG - Intronic
1134566012 16:15252523-15252545 ATCTCAAGAAAGCAGGGATAAGG - Intergenic
1134736482 16:16504175-16504197 ATCTCAAGAAAGCAGGGATAAGG + Intergenic
1134931032 16:18207993-18208015 ATCTCAAGAAAGCAGGGATAAGG - Intergenic
1135396918 16:22138589-22138611 GGCTGGGGCCAGCAGGGATGGGG + Intronic
1135765109 16:25170791-25170813 AGCTGAAGTGAGCAGGTATGGGG + Exonic
1136925771 16:34372510-34372532 AGGTGAAGCTTGCTGGGATAAGG - Intergenic
1136978803 16:35039296-35039318 AGGTGAAGCTTGCTGGGATAAGG + Intergenic
1137446749 16:48536605-48536627 AGCTGAAGCCACCAGGCAGGAGG + Intergenic
1140868713 16:79087331-79087353 AGCTGAAGCTAGCATGGGCAGGG + Intronic
1141758877 16:86013649-86013671 TGCTGAAGTCCTCAGGGATAGGG + Intergenic
1142228165 16:88887455-88887477 AGCTGAGGCCAGCTGGGAGCCGG + Intronic
1142504573 17:354688-354710 ACTTGAACCCAGCAGGGACAGGG + Intronic
1142597097 17:1035247-1035269 AGCTGAACCCAGCAGAGATGAGG - Intronic
1143357160 17:6338829-6338851 AGCTCAAGCAAGCAGGGAGATGG - Intergenic
1146053723 17:29570884-29570906 AGCTGATGCCAGCTGGGACTGGG - Intronic
1146059593 17:29597521-29597543 AGCTGAGGCCTGCTGGGATAAGG + Intronic
1146258924 17:31409112-31409134 TGGTGGAGCCAGTAGGGATAAGG + Intronic
1146568126 17:33930781-33930803 AGCTGGTGCCAGCAGGAAAATGG + Intronic
1147888264 17:43698990-43699012 AGAAGGAGCCAGCAGGGATAGGG - Intergenic
1148674050 17:49434830-49434852 ACCTGTAGCCAGAAGGGATGAGG + Intronic
1150643240 17:66963692-66963714 AAGTGAAGCCAGCAGGGGTTGGG + Intergenic
1150809115 17:68342845-68342867 AGCTGAAACCAGAAGGGAGAGGG + Intronic
1150835278 17:68558177-68558199 GGCTGAAGCCAGCAAGGAAATGG + Intronic
1152192671 17:78898006-78898028 AGCTGGAGGCGGCAGGGACAAGG - Intronic
1154087337 18:11320278-11320300 ACCAGATGCCAGCAGGGATGGGG + Intergenic
1154482804 18:14853330-14853352 AGCTGAGGTCAGGAGGGATGTGG + Intergenic
1156130096 18:33962106-33962128 AGCTGAATCCAGCAGAGCTAAGG + Intronic
1158302193 18:56064679-56064701 AGCTGAAGATAGAAAGGATAGGG - Intergenic
1158519810 18:58162416-58162438 AGCTGAAGCCTGAAGGAAGAAGG - Intronic
1159843768 18:73433303-73433325 AACAGAGGCCAGCAAGGATATGG + Intergenic
1160718242 19:586038-586060 AGGTGAGCCCAGCAGGGAGAAGG + Intergenic
1161123868 19:2545123-2545145 AGGTGAAACCCCCAGGGATAGGG - Intronic
1161190067 19:2949563-2949585 AAGTGAAGACAGCAGGGTTACGG - Intergenic
1162068242 19:8138380-8138402 AGCTGCAGCCTGCAGGGCTGTGG - Intronic
1162147610 19:8622422-8622444 AGCAGGAGACAGCAGGGAGACGG - Intergenic
1162371688 19:10283795-10283817 TGAAGAAGCCAGCAGGGAGAAGG + Intronic
1162940998 19:14009125-14009147 TGCTAAAGCCAGGAGAGATAAGG + Intergenic
1163270905 19:16252758-16252780 GGCTGAGGCCAGCAGGGTTGTGG + Intergenic
1166747320 19:45147510-45147532 ACCTGAAGCCAGGAGGTATCTGG - Intronic
1167008179 19:46788605-46788627 AGCGGAAGCTGCCAGGGATAAGG + Intergenic
1168686287 19:58351365-58351387 AGCCGGGGCCAGCAGGGACAGGG - Intronic
926799524 2:16647607-16647629 AAATGAAGACAGCAGTGATATGG - Intronic
926922281 2:17951017-17951039 AGCTGAAGGCAGAAGGAATTGGG - Intronic
928115932 2:28545279-28545301 AGCCTCAGCCAGCAGGGACATGG + Intronic
931169794 2:59790743-59790765 AGATGAAGACAGCAGAGACAAGG - Intergenic
932090015 2:68797907-68797929 GGCTGAGGCCAGCTGGGAAAGGG - Intronic
933736607 2:85500261-85500283 AGCTGAAGCCAAAAGGTATTTGG - Intergenic
934040942 2:88127063-88127085 TGCTGAAGACAGCAGGGGCAGGG - Intronic
934614900 2:95764714-95764736 ACCTGCAGCCAGAAAGGATAGGG - Intergenic
934715916 2:96543248-96543270 ATCTGAAGCCAGAATGGTTATGG - Intronic
934819265 2:97357800-97357822 ATTTGAAGCCAGTAAGGATATGG + Intergenic
935270420 2:101429740-101429762 AGCTGAAACCATCAGGCATGAGG - Intronic
935666214 2:105515303-105515325 CTCTGGAGCCAGCAGGGATGTGG - Intergenic
937200993 2:120204450-120204472 AGCTGTAGCCAGCATGGCTCTGG - Intergenic
938337548 2:130512766-130512788 GGCTGAGGTCAGCAGGTATAAGG - Intergenic
938352291 2:130607969-130607991 GGCTGAGGTCAGCAGGTATAAGG + Intergenic
940358040 2:152767029-152767051 AGTGGAAGCCAGAAGGAATATGG + Intergenic
940880031 2:158937388-158937410 AGCTGATGTCAGCAGAGAGACGG + Intergenic
941032776 2:160532129-160532151 AGCTGAAGCCAAGAAGGAAAAGG - Intergenic
941516171 2:166481892-166481914 AGGTGAAGCCAGAAGAGATTTGG + Intronic
943098688 2:183460097-183460119 AGCTGAATGCAGCTGGTATATGG - Intergenic
945551731 2:211229130-211229152 ACCTGAAGCCAGCATGGCTCAGG - Intergenic
947509085 2:230734430-230734452 TGTTGAGGCCAGCAGGGATGTGG + Intronic
948275284 2:236703796-236703818 GGCTGAAGACAGCCGGGAAAGGG - Intergenic
1169489039 20:6056009-6056031 TGCTGAGGCCAGCAGGGGTTTGG + Intergenic
1169545770 20:6649051-6649073 AGCTGATTCCAGCAAGGAAATGG + Intergenic
1172778078 20:37419803-37419825 AGCTGGAGGCAGCAGTGAGAGGG - Intergenic
1172819786 20:37721484-37721506 ACCAGAAGCTAGCAGGGATCAGG - Intronic
1174948021 20:55010179-55010201 TGCTGAAGCCACCAGGAAGAAGG + Intergenic
1175867922 20:62191248-62191270 AGCTGCAGGCAGCCGGGATAGGG + Intronic
1176797796 21:13383230-13383252 AGCTGAGGTCAGGAGGGATGTGG - Intergenic
1179478173 21:41661023-41661045 GGCTGAGGCCAGCGGGGAGAAGG + Intergenic
1180605465 22:17055918-17055940 GGCTGAAGCAAGCAGGCATTTGG + Intergenic
1182416152 22:30222692-30222714 GGCTGTAGACAGCAGGGATGCGG - Intergenic
1183150961 22:36037211-36037233 AGCAGGTGCCAGCAGGGACAAGG - Intergenic
1183317505 22:37145016-37145038 AGCTAAAGTCAGCAGGTAGAGGG + Intronic
1183779286 22:39988546-39988568 GGCTGTAGCCTGCAGGGATAGGG + Intergenic
1184264054 22:43337366-43337388 GGCTTAAACCAGCAGAGATAGGG + Intronic
1184613524 22:45622133-45622155 TTCTGGAGCCAGCAGGGATGGGG - Intergenic
1185205666 22:49536620-49536642 CTCTGAAGACAGCAGGAATAAGG + Intronic
950025880 3:9819649-9819671 AGCTAAATCCAGAAGGGAAAGGG - Intronic
952897252 3:38085837-38085859 AGCTGAAGCCAGCTTTGCTAAGG - Intronic
953782788 3:45886370-45886392 AGCTGAAAACTGCTGGGATAAGG - Intronic
959291872 3:104485122-104485144 AGCTGAAGCCAGGAGGCAAGTGG + Intergenic
960437142 3:117641386-117641408 AACTAAAGCCAGCAGGAAGAAGG - Intergenic
960863838 3:122180818-122180840 AGATGATGCCAGCTTGGATAGGG + Intergenic
960912056 3:122659022-122659044 GGCAGAGGCCAGGAGGGATATGG + Intergenic
961018119 3:123482783-123482805 AACTGATGCCAAGAGGGATAGGG - Intergenic
962754965 3:138459877-138459899 AGCTGAGCCCAGCAGGCATGGGG + Intronic
962832512 3:139157171-139157193 AGCTGAAGCCAGCACAGACCTGG - Intronic
962865951 3:139448137-139448159 TGCTGATGCCACAAGGGATAAGG - Intergenic
963909947 3:150808290-150808312 ATCTGAAGTCAACAGGGATGTGG - Intergenic
964082943 3:152782814-152782836 AGCTGAAGCCAACAAGGCAATGG - Intergenic
965066619 3:163858013-163858035 AGTGGAAGCCATCAAGGATAGGG - Intergenic
968433515 4:573353-573375 GCCAGAAGCCAGCAGGGATGGGG + Intergenic
968626175 4:1627674-1627696 AGCTGAGGCCTGCAGGGGAAGGG + Intronic
969437226 4:7195035-7195057 AGCTTGGGCCAGCAGGGATGGGG + Intronic
972585612 4:40434916-40434938 TGCTGAAGCCAGGAGGGGTCTGG + Intronic
973704057 4:53564343-53564365 GGGTGAAGCCAGAAGGGATGTGG - Intronic
975464864 4:74697906-74697928 AGCTGAAGCCAATAGGTATGTGG + Intergenic
977576898 4:98684463-98684485 AACTGAAGCCACCAGTGTTAAGG + Intergenic
979354104 4:119682158-119682180 GGCTGAAGACAGCCAGGATATGG + Intergenic
983601000 4:169527718-169527740 ATCTAAAGGCAGCAGGGAAATGG + Intronic
984227236 4:177050246-177050268 AGCTGGAACCAGCAGGAATGAGG - Intergenic
984816761 4:183845326-183845348 AGCTTAAGCCAGGTGGGATATGG + Intergenic
985776841 5:1848767-1848789 AGGTGAAGCCACAAGGGACATGG - Intergenic
986818996 5:11445154-11445176 AGCAGAAGCCAGCAGGGAAAAGG - Intronic
990608286 5:57432023-57432045 TGCTGAAGCCTCCAGGCATATGG + Intergenic
990614199 5:57490422-57490444 AGGTGAAGCCAGCAGGTAGCGGG + Intergenic
990738349 5:58888184-58888206 ACATGAGGCCAGCAGGGAAATGG - Intergenic
992804467 5:80323398-80323420 TGATGATGCCAGCAGGGAAAAGG - Intergenic
993155407 5:84215843-84215865 AACTGAAGCCAGAAGGGCAATGG + Intronic
994353685 5:98773198-98773220 AGCTGAAGCTGGCAGGGCCAGGG + Intronic
994587620 5:101730027-101730049 AGCTGAAGCTTGAAAGGATAAGG + Intergenic
996727277 5:126683669-126683691 AGCAGAAGGCAGAAGGGATCAGG - Intergenic
997179771 5:131815867-131815889 TGCTGAAGGCAGAAGGAATATGG + Intronic
997333085 5:133081562-133081584 AGCTGAAATCAGCAGGGGTTTGG - Intronic
998184128 5:139965809-139965831 AGGTAAAGCCAGCAGAGGTATGG + Intronic
998554242 5:143107468-143107490 AGCTGATGGCAGCTGAGATAGGG - Intronic
1001232529 5:170001064-170001086 AGCTGAAGCAGGCAGGGCTGGGG - Intronic
1002824865 6:763575-763597 AGCAGAGGCCAGAAGGGCTAAGG - Intergenic
1003893892 6:10588694-10588716 AGATGAGGTTAGCAGGGATATGG + Intronic
1004301535 6:14462687-14462709 AGGAGAAGGCAGCAGGGATATGG - Intergenic
1004340064 6:14800186-14800208 AGCTGCAGCCAGCAGGAAGGAGG - Intergenic
1005987159 6:30882531-30882553 AGCTGGAGCCAGCTGGAATGCGG - Intronic
1006421463 6:33936572-33936594 GGCTGATGCCAGCAGGAAAAGGG + Intergenic
1006909673 6:37555774-37555796 CCCTGAAGCCAGCAGGGGTGTGG + Intergenic
1007413885 6:41680787-41680809 AGCTGAAGACAGCAGGGTCAGGG + Intergenic
1008090525 6:47289569-47289591 AGGTAAAGTCAGAAGGGATAAGG - Intronic
1008962604 6:57280946-57280968 AGCAGAGGCCAGGAGGGATGGGG - Intergenic
1009444777 6:63728974-63728996 ACCTAAAGCCAGCAAGGATATGG - Intronic
1010324499 6:74549632-74549654 AGCTGAAGCCAGCAGAGCACTGG + Intergenic
1011879853 6:92011667-92011689 AGGTGAAGCCAGCTGGGACTTGG - Intergenic
1012399910 6:98834578-98834600 AGCTGGAGAGAGCAGGGAGAGGG + Exonic
1013664034 6:112328460-112328482 TGCTGAAACCAGGATGGATATGG - Intergenic
1013801258 6:113947334-113947356 AGCTGATGGCAGCAAGGAGATGG + Intronic
1014363948 6:120516686-120516708 TGCTTAAGCCAACAGTGATAAGG - Intergenic
1015015707 6:128410290-128410312 AGCTGATCGCAGCAGGGAGAGGG - Intronic
1015821555 6:137266685-137266707 AGACTAAGCCAGCAGGAATATGG - Intergenic
1019432551 7:1005913-1005935 AGCTAAAGCCTGCAGGGACCAGG + Intronic
1019984628 7:4646681-4646703 AGCTGAGGCCATCAGTCATATGG + Intergenic
1020002100 7:4761977-4761999 GGCTGGAGCCAGCAGAGACAGGG + Intronic
1020801610 7:12739364-12739386 AGCTGAAGCCAACTGGGTCAGGG - Intergenic
1021089967 7:16472058-16472080 AGGTGAGGACAGCAGGGACAGGG + Intronic
1021955291 7:25818317-25818339 AGCTTAAGGCAGCAGGTATAAGG + Intergenic
1024629168 7:51233228-51233250 AGCTGAAGGCAGCACTGATTTGG - Intronic
1026683986 7:72492598-72492620 AGCTAATGCCAGCAGGGCTGTGG + Intergenic
1026958592 7:74394144-74394166 AGCTGTTGACAGCAGGGAGACGG - Intronic
1026958741 7:74395062-74395084 AGCTGTTGACAGCAGGGAGACGG - Intronic
1027668118 7:81064679-81064701 AGCTGGCGCTGGCAGGGATAAGG - Intergenic
1027878179 7:83798679-83798701 TGGTGAAGCCAGCAACGATATGG + Intergenic
1028179890 7:87706864-87706886 AGCTGAAAGCAGCAGGGAAGAGG + Intronic
1028892976 7:96009463-96009485 AACTGAAGCCAGCAGAGTCAGGG + Intronic
1029578192 7:101418178-101418200 TCCTGAAACCAGCAGGGACAAGG + Intronic
1029711451 7:102302244-102302266 AGCCGAGGCCTGCAGGGATGAGG + Intronic
1029782003 7:102744260-102744282 ACCCCAAGCCTGCAGGGATAGGG - Intergenic
1031412520 7:121456924-121456946 ACCTGAAGCCAGCAGGGTGCTGG + Intergenic
1032108549 7:129055313-129055335 AGCTGAAGGCAGCTCAGATATGG - Intergenic
1032494767 7:132352594-132352616 ACCTGAATACAGGAGGGATATGG + Intronic
1033851592 7:145502739-145502761 AGCTGAACTCAGCAGGAATTGGG + Intergenic
1034406944 7:150910782-150910804 AGCAGAAACCAGAAGGGATGAGG + Intergenic
1034545256 7:151784997-151785019 AGCTGAAGCCACCAGGGACAGGG + Intronic
1035094934 7:156346416-156346438 AGCAGAAGGAAGCAGGGAGAAGG + Intergenic
1035542083 8:448103-448125 AGCTGAAGAGAACAGGGAGAGGG + Intronic
1035585399 8:768978-769000 AGCTGCAGCCATGAGGGATAAGG - Intergenic
1037765693 8:21770916-21770938 AGGTGAAACCAGCTGGGATTCGG + Intronic
1038172059 8:25144564-25144586 ACAGGAAGCCAGCAGGGATAAGG + Intergenic
1039361505 8:36882241-36882263 ACCTGAAACCAGCAGGGCTGTGG + Intronic
1040924496 8:52664151-52664173 AGTTGAAGCTAGGAGGTATATGG - Intronic
1043495213 8:80792679-80792701 TGCTGAAGCAAGCTGGTATATGG + Intronic
1044131959 8:88534417-88534439 AGCTGCAGCCAGCTGGGAGTTGG + Intergenic
1047126809 8:121971808-121971830 AGCAGAAGCCAACAGCGAAATGG + Intergenic
1047138368 8:122107159-122107181 ACCTGAAGCCAGCAAGGCTCTGG + Intergenic
1047724929 8:127676142-127676164 AGCTGAATGCAGAATGGATATGG - Intergenic
1047868488 8:129056122-129056144 AGCTGAAGGCAGCAGAGGTAAGG - Intergenic
1048989125 8:139751042-139751064 AGGGCAAGCCAGCAGGGCTATGG + Intronic
1049255580 8:141612006-141612028 AGCTGGGGACAGCAGGGATGGGG - Intergenic
1049709644 8:144057762-144057784 AGGAGTAGGCAGCAGGGATAGGG + Intronic
1049743833 8:144254675-144254697 AGCTGCAGCCAGCTGGGAAATGG - Intronic
1052569139 9:30198782-30198804 GGCTGCAGCCTGCAGGGATTGGG - Intergenic
1053503441 9:38621008-38621030 AGCTGTCGCCAGCAGGTAGAGGG + Intergenic
1054809365 9:69422569-69422591 AGATGCAGCCAGCAGGCAGAGGG - Intergenic
1055797271 9:79988467-79988489 ATCTGTAGCCAGCAGGAGTAAGG + Intergenic
1056273949 9:84974797-84974819 AGCTGAAGCCAGCAGGGATAAGG - Intronic
1056808731 9:89747873-89747895 TCCTGAAGACAGCAGGGATGCGG + Intergenic
1057152694 9:92808901-92808923 AGCTGTTGCCAGCAGGTAGAGGG - Intergenic
1058974685 9:110114998-110115020 AGCATAAGCCAGCAGGGATACGG - Intronic
1060357091 9:122919409-122919431 ATCTGAAGACAGTATGGATATGG - Exonic
1060765602 9:126293390-126293412 AGCTGGAGCCAGCAGGGGCTGGG + Intergenic
1060879419 9:127107744-127107766 TGCTGGAGCCAGCAGGGTGACGG - Intronic
1061431845 9:130536304-130536326 AGCAGCTGCCAGCAGGGCTAGGG + Intergenic
1061558023 9:131383999-131384021 AGCTGAACCCAGGAGGCAGAGGG - Intergenic
1061778793 9:132983915-132983937 AGCTGAAGCCTGGAGGGCTCAGG - Intronic
1185643156 X:1599518-1599540 AGCTGCAGCCGGCGGGGAAACGG - Intronic
1185655215 X:1678987-1679009 AGATGAAGCCAGCAGGTAGCAGG + Intergenic
1186222316 X:7363161-7363183 AGCTGGAGGGAGGAGGGATAAGG + Intergenic
1187205439 X:17176975-17176997 GTCTGAAGCCAGCAGAGCTAAGG - Intergenic
1188381601 X:29500430-29500452 ACCTGAGGCCAGGAGGGGTAAGG - Intronic
1188796752 X:34476308-34476330 AGGTGCAGCCAGCAAGCATATGG - Intergenic
1190381551 X:49843940-49843962 AGCTGCAGGCAGAAGGGATCGGG - Intergenic
1190898775 X:54648356-54648378 AGGTGAAGCAAGCAGGCAGATGG - Intergenic
1191116748 X:56860674-56860696 ACCTGAAGTCAGCAGGGCTCTGG + Intergenic
1191912736 X:66168287-66168309 AACTGCAGCCAGGAGGGAAAAGG + Intronic
1192205227 X:69091397-69091419 AGCTCCAGGCAGCAGGGATAAGG - Intergenic
1193094418 X:77530759-77530781 AGCTGAAGCAAACAGAGACATGG + Intronic
1193833219 X:86312055-86312077 TGCTGAAGGCAACAGGAATACGG + Intronic
1196903539 X:120409991-120410013 AGTGGAAGCCATCAAGGATAGGG + Intergenic
1197498007 X:127209554-127209576 AGTTAAAGCCAGCAAGGAAAAGG - Intergenic
1199861285 X:151802138-151802160 AGCTTCAGCGAGCAGGGACAAGG - Intergenic
1199878459 X:151954005-151954027 AGATGGAGCCAGCAAGGAGAGGG + Exonic