ID: 1056273950

View in Genome Browser
Species Human (GRCh38)
Location 9:84974803-84974825
Sequence AGGGAAAGCTGAAGCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 579}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056273950_1056273963 26 Left 1056273950 9:84974803-84974825 CCCTGCTGGCTTCAGCTTTCCCT 0: 1
1: 0
2: 5
3: 43
4: 579
Right 1056273963 9:84974852-84974874 GTTTGGGAGTTAAGGGGAGCAGG No data
1056273950_1056273958 10 Left 1056273950 9:84974803-84974825 CCCTGCTGGCTTCAGCTTTCCCT 0: 1
1: 0
2: 5
3: 43
4: 579
Right 1056273958 9:84974836-84974858 AAGGAAGTCGCCGGCTGTTTGGG No data
1056273950_1056273955 1 Left 1056273950 9:84974803-84974825 CCCTGCTGGCTTCAGCTTTCCCT 0: 1
1: 0
2: 5
3: 43
4: 579
Right 1056273955 9:84974827-84974849 AGCAGCCTCAAGGAAGTCGCCGG No data
1056273950_1056273960 19 Left 1056273950 9:84974803-84974825 CCCTGCTGGCTTCAGCTTTCCCT 0: 1
1: 0
2: 5
3: 43
4: 579
Right 1056273960 9:84974845-84974867 GCCGGCTGTTTGGGAGTTAAGGG No data
1056273950_1056273957 9 Left 1056273950 9:84974803-84974825 CCCTGCTGGCTTCAGCTTTCCCT 0: 1
1: 0
2: 5
3: 43
4: 579
Right 1056273957 9:84974835-84974857 CAAGGAAGTCGCCGGCTGTTTGG No data
1056273950_1056273959 18 Left 1056273950 9:84974803-84974825 CCCTGCTGGCTTCAGCTTTCCCT 0: 1
1: 0
2: 5
3: 43
4: 579
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data
1056273950_1056273952 -9 Left 1056273950 9:84974803-84974825 CCCTGCTGGCTTCAGCTTTCCCT 0: 1
1: 0
2: 5
3: 43
4: 579
Right 1056273952 9:84974817-84974839 GCTTTCCCTAAGCAGCCTCAAGG No data
1056273950_1056273962 20 Left 1056273950 9:84974803-84974825 CCCTGCTGGCTTCAGCTTTCCCT 0: 1
1: 0
2: 5
3: 43
4: 579
Right 1056273962 9:84974846-84974868 CCGGCTGTTTGGGAGTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056273950 Original CRISPR AGGGAAAGCTGAAGCCAGCA GGG (reversed) Intronic
900467934 1:2834936-2834958 AGGAAAAGCTGAGGCAAGGATGG - Intergenic
900968472 1:5975976-5975998 AGGGAGAGCTGAAGTCAGAGGGG + Intronic
901489751 1:9590550-9590572 ATGGAGAGCTGTGGCCAGCAGGG - Intronic
901674084 1:10872850-10872872 GGGGCAAAATGAAGCCAGCATGG - Intergenic
901794610 1:11673124-11673146 AGGGAGCGCTGAAGCCAGCTGGG + Intronic
901904408 1:12395207-12395229 GTGGAAAGCTGATGACAGCATGG + Intronic
902688422 1:18094295-18094317 AGTGAAAGCTGAAGGCAGTTAGG - Intergenic
902749025 1:18493740-18493762 AGGGAAATCTGAATCAAGTATGG - Intergenic
903006779 1:20303821-20303843 TGTGATGGCTGAAGCCAGCAGGG + Intronic
903186463 1:21632072-21632094 ATGGAAAGCTGGAGCCAACCTGG + Intronic
903252820 1:22068824-22068846 AGCACAAGCTGAAGCCAGCATGG - Intronic
903681336 1:25099277-25099299 AACCAAAGCTGAGGCCAGCAGGG + Intergenic
904266398 1:29320658-29320680 AGGGAAACCGGAACTCAGCAGGG - Intronic
904374288 1:30070112-30070134 TTGGAAAGTTGAAGCCAGCAAGG + Intergenic
904420695 1:30389364-30389386 AGGGCAGGGTGAGGCCAGCAGGG + Intergenic
904447307 1:30585578-30585600 AGGGAAAGCTGAAGCAGGGCGGG - Intergenic
904466976 1:30714089-30714111 AGAATAAGCTGAAGCCAGCTTGG - Intronic
904713015 1:32445254-32445276 AAGGAAAACTCAAGCCAGCCTGG - Intergenic
905200989 1:36316740-36316762 AGAGAGAACTGAAGCCAGAAAGG - Intronic
905276135 1:36819415-36819437 AGGGTCAGCCGCAGCCAGCAGGG + Intronic
905288672 1:36906152-36906174 AAGGAATGCTGAACCCCGCAGGG + Intronic
905312636 1:37060785-37060807 GGGGAAAGCTGGAGTCAGGATGG - Intergenic
905463925 1:38138937-38138959 AGGCAAAGCTGTGGGCAGCAGGG - Intergenic
905870187 1:41399153-41399175 AGAGAAGACAGAAGCCAGCATGG + Intergenic
906431021 1:45755900-45755922 AGGGAAAGCTCAAACCAACCTGG - Intergenic
906657003 1:47555702-47555724 AGGAAAGGCTGTAGCCAGGATGG - Intergenic
906718792 1:47990532-47990554 AGGGAAAGAGGAAGGCTGCATGG - Intronic
906753311 1:48285732-48285754 AGGGAAAGCTGAAGCTGGGTGGG - Intergenic
907496892 1:54851353-54851375 TGGGAAAGATGAGGCCTGCAGGG + Exonic
907708011 1:56849434-56849456 AGGGGCAGATGAAGCCAGCCTGG + Intergenic
908342202 1:63193121-63193143 AGGCAAAGCTGAAGCGAGGTAGG + Intergenic
908788269 1:67756352-67756374 AGACAAGGCTGAAGTCAGCAAGG + Intronic
909604699 1:77496666-77496688 AGTGAGAGGTGAAGCCAGCTGGG + Intronic
910561518 1:88597141-88597163 TGGAAAGGCTGAAGGCAGCATGG - Intergenic
910688160 1:89939446-89939468 AGGGAAGGCTGAAGCCAAGGGGG + Intergenic
911632451 1:100198760-100198782 AGGGAAAGTGGATGCCAGGAAGG + Intronic
912202478 1:107473812-107473834 TGGAAAAGCTGAAGTCAGCAAGG - Intronic
912378842 1:109235517-109235539 AGGAAAAGCTGGAGCCAGGATGG - Intronic
913225905 1:116697949-116697971 TGGGAAAGCTGCAGTCAACAGGG + Intronic
914680952 1:149937928-149937950 ACTGAAAGCTGAGGCCAGAAGGG - Exonic
915185984 1:154105570-154105592 AGTCACACCTGAAGCCAGCATGG - Intronic
916896062 1:169163126-169163148 GGGGAAAGATGAAGGAAGCAAGG + Intronic
916943766 1:169703360-169703382 AGGTAAAGCTGAAGCTGGCCAGG + Exonic
917028100 1:170663791-170663813 GAGGAAAGCGGAGGCCAGCAGGG - Intronic
917280772 1:173376470-173376492 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
917598372 1:176552341-176552363 AGGGAAAGGGGAAGGGAGCAAGG - Intronic
918177478 1:182058486-182058508 AGGGACAGCAAAAGCCAGCCTGG - Intronic
919083763 1:192895956-192895978 AGTGAGAGGTGAAGCCAGCTGGG - Intergenic
919138839 1:193544602-193544624 AGGGAAAACTGAAGGAAACAGGG + Intergenic
919576959 1:199322389-199322411 AAGCAAAGCAGAAGCCAGGAAGG - Intergenic
920516423 1:206587870-206587892 GGGGAAGGCTGAAGACAGCTTGG - Intronic
921136114 1:212260697-212260719 AGTGAAAGATCAAGCCAGCTGGG + Intergenic
921789041 1:219268480-219268502 AGTGAAAGCTAAAGTCAGAAAGG + Intergenic
922412222 1:225387916-225387938 ATGGAAAGCTGAATCCACAAGGG + Intronic
922570835 1:226633988-226634010 AGAGAAGGCTGAAGCCAGCTTGG - Exonic
922584822 1:226725673-226725695 AGGGAAGGCTGGAGTGAGCAAGG - Intronic
923076982 1:230618446-230618468 AGGGAATTCTGAAGACAGGAGGG - Intergenic
923150738 1:231231108-231231130 AAGAAAATCTGAAGCCAGGAAGG - Intronic
923394190 1:233544354-233544376 AGGGAAAGCCAAAGGCATCAAGG - Intergenic
1062847990 10:722621-722643 AGGGACAGCAGAACACAGCAGGG + Intergenic
1063212071 10:3889957-3889979 GGAGAAATGTGAAGCCAGCAGGG - Intergenic
1064402106 10:15030072-15030094 AAGGAAAGCTGAGGTCAGCTAGG + Intergenic
1064691776 10:17926152-17926174 AGGGAAAGAGGAAGCAAGAAGGG - Intergenic
1064694359 10:17950700-17950722 AGTGAGAGGTGAAGCCAGCTGGG - Intergenic
1064756460 10:18575963-18575985 AGGAGAAGCTCAAGCCAGCCTGG + Intronic
1066000909 10:31103348-31103370 GGGGGAAGGTGAAGCCTGCAGGG + Intergenic
1066139617 10:32490108-32490130 AGAGACAGCTGGAGACAGCAAGG - Intronic
1067355886 10:45525998-45526020 AGGGAAATCTGAATAAAGCATGG + Intronic
1067465883 10:46498443-46498465 TTTGAAAGCTGAAGCCAGCTGGG + Intergenic
1067621304 10:47886163-47886185 TTTGAAAGCTGAAGCCAGCTGGG - Intergenic
1067763178 10:49065320-49065342 AGGTAAAGCTGAAACAACCAGGG + Intronic
1068414405 10:56699229-56699251 ATGGAATGCTGAAGCCAGGCTGG + Intergenic
1068874995 10:61986427-61986449 AAGGAGAGCTGAAGGGAGCAGGG + Intronic
1068965394 10:62906805-62906827 AGGTAAAGATGAATTCAGCACGG - Intronic
1068986725 10:63114512-63114534 AGGGACAGCAGCAGGCAGCATGG + Intergenic
1069663424 10:70138887-70138909 CCAGAAGGCTGAAGCCAGCACGG + Exonic
1070178786 10:73995556-73995578 TGGGGAAGCTGAAGGCAGTAAGG + Intergenic
1070320351 10:75350365-75350387 AGAGAAAGCAGAAGCCATCCTGG + Intergenic
1070567600 10:77615497-77615519 AGGGACTGCTGGAGCCACCAGGG + Intronic
1071991929 10:91108108-91108130 TGGGAAAGCTAAGGGCAGCATGG - Intergenic
1072360148 10:94651638-94651660 AGGAAAGGCTGATGGCAGCATGG - Intergenic
1072614039 10:97037819-97037841 AGGGAAGGCTGTCCCCAGCATGG - Intronic
1072903996 10:99433879-99433901 TTGGAAATCTGAAGCCTGCAGGG + Intergenic
1072970813 10:100015912-100015934 AGGCAAAGGAGAAGTCAGCATGG + Intergenic
1073253348 10:102135229-102135251 AGGGAAAAGTGAAGCCCTCAAGG + Intronic
1073337555 10:102721111-102721133 AGGCAATCCTGAAGTCAGCAGGG - Intronic
1074276486 10:112007238-112007260 AATGCAAACTGAAGCCAGCATGG + Intergenic
1074612652 10:115036899-115036921 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
1075089804 10:119437284-119437306 AGAGCAAGCTGAGGACAGCATGG - Intronic
1075932908 10:126314307-126314329 AGGGAGAGCAGAAACCAGCTGGG + Intronic
1076096671 10:127738596-127738618 GAGGAGAGCTGAAGCCAGCGCGG + Exonic
1076328999 10:129651222-129651244 AGGGAAGGCTGAGGCCAAGACGG - Intronic
1076518504 10:131063442-131063464 AGGTTGAGCAGAAGCCAGCAAGG - Intergenic
1076654065 10:132009847-132009869 TGGGAAAACTGGAGGCAGCAGGG - Intergenic
1077553615 11:3215382-3215404 AGGGACAGCAGAAGGCAGCGAGG + Intergenic
1078667736 11:13340313-13340335 AGGAAAAGCGGAACCCAGCAGGG - Intronic
1078930653 11:15910020-15910042 AAGGAAAGATGATGCCACCATGG + Intergenic
1079034643 11:17011620-17011642 GGTGAGAGGTGAAGCCAGCAAGG - Intronic
1079525954 11:21388101-21388123 AAGGAAGGCTGAAGGCAGTATGG - Intronic
1080688481 11:34535661-34535683 AGAGAAAGCTAAAGCCAGAAAGG + Intergenic
1080845747 11:36025374-36025396 AAAAAAATCTGAAGCCAGCATGG - Intronic
1081033803 11:38116661-38116683 ATTGAAAGGTGAAGCCAGCTGGG + Intergenic
1081623984 11:44635691-44635713 AGGGAGATCAGAAGGCAGCAGGG + Intergenic
1081635481 11:44718691-44718713 AGGGAAAGTTGGAGAGAGCAGGG + Intergenic
1081867340 11:46366987-46367009 AGGTATAGCTGTGGCCAGCAGGG + Intronic
1083147762 11:60771677-60771699 AGGGAAAGCTGGAGAATGCACGG + Intronic
1083302283 11:61745443-61745465 AGGGAAAGCTGAGGGGAACAGGG - Exonic
1084639754 11:70418172-70418194 AGGGAAATGCCAAGCCAGCATGG - Intronic
1085409901 11:76284689-76284711 AGGGCAGGGTGAAGACAGCAGGG + Intergenic
1085645289 11:78218643-78218665 AGGGAAAGCTGACATCTGCAGGG - Exonic
1085771795 11:79332123-79332145 AGAGAAAACTGAAACCAGAAAGG + Intronic
1086576240 11:88341730-88341752 TGGGAAAGCTGAGGGCACCAGGG - Intergenic
1087123583 11:94600203-94600225 AAGCAAAGATGAAGCCAGGATGG - Intronic
1087155233 11:94895471-94895493 ATGGAAAACTGATGCCAACATGG - Intergenic
1087445034 11:98240424-98240446 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
1088864228 11:113831748-113831770 GGGGAAAGCTGAAGGCGACAGGG + Intronic
1088901682 11:114122746-114122768 AGGGAAAGCTGAATCAAGCCTGG - Intronic
1089200841 11:116723887-116723909 AAGGAAGGCTAAAGCCACCAGGG - Intergenic
1089441340 11:118520043-118520065 AGGTACAGCTGAAGTCAGCTCGG + Exonic
1089498155 11:118918153-118918175 AGGGAAAGCTGGAGGAAGCTGGG - Intronic
1089534544 11:119152611-119152633 GGGGAAGGATGAAGCCACCAAGG - Intronic
1089579902 11:119475127-119475149 ACGGACAGCCCAAGCCAGCAGGG - Intergenic
1089610386 11:119665372-119665394 AGGGAAAGGAGAGGCCAGGAAGG + Intronic
1089976936 11:122740736-122740758 GGGGCAAGCTGAAGGCAGAAAGG + Intronic
1090183931 11:124723912-124723934 AGGGAAAGATGAAGTGAGGAAGG - Intergenic
1090472048 11:126989549-126989571 AAGGAAAGGTGCAGCCACCATGG - Intronic
1090722944 11:129493626-129493648 AGGGCAAGCTGAAGCAGGGAGGG + Intergenic
1090929327 11:131281365-131281387 AGGGAAAGCTGTCACCAGCATGG - Intergenic
1090938319 11:131365266-131365288 AGGGAGAGCTGCAGCCATCTTGG - Intergenic
1091187913 11:133663135-133663157 AGGGAATGATGATGCCAGCCTGG + Intergenic
1092670599 12:10856603-10856625 ATGCAAATCTGAAACCAGCAGGG - Intronic
1093501944 12:19823378-19823400 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
1093523382 12:20076386-20076408 AGGAAGAGGTGAAGCCAGGATGG + Intergenic
1094457314 12:30651187-30651209 AGGGAAAACTGAAGACTGCCCGG + Intronic
1094496005 12:30989822-30989844 AGAGGAAGCTGAAGGCAGGACGG + Intronic
1094788443 12:33880052-33880074 ATGGAAAGCTGAAAAAAGCAGGG - Intergenic
1095898833 12:47306617-47306639 AGTGAAAGGTGAAGCCTGCTGGG + Intergenic
1096204530 12:49709687-49709709 AGTGAAAGATGAAGTCAGAAAGG + Intronic
1096738628 12:53675916-53675938 AGGGATAGCGGAAGCAAGAAAGG + Intronic
1096806856 12:54146281-54146303 AGGGACAGCTGAAGGCACGAGGG - Intergenic
1097160920 12:57046261-57046283 AGGGAAAGCAGAACCCAGGCAGG + Intronic
1097473501 12:60024762-60024784 AGGGAAAGCACATGCAAGCATGG - Intergenic
1098007763 12:66017234-66017256 AGGGAAAGTTCAAGCAAGAATGG - Intergenic
1099159500 12:79223514-79223536 TGGGACAGCTGTGGCCAGCATGG + Intronic
1099419189 12:82432645-82432667 AGGGCAAGTTAAGGCCAGCATGG - Intronic
1100235440 12:92655955-92655977 AGTGAAAGCTGAAGCGGGCTTGG + Intergenic
1100438598 12:94594594-94594616 AGGAAGAGGGGAAGCCAGCAAGG + Intronic
1102630503 12:114274654-114274676 AGGCAAAGTAGGAGCCAGCATGG + Intergenic
1102865179 12:116368576-116368598 AGGGCAAGAAGAAGCCAGCCTGG - Intergenic
1102922598 12:116803449-116803471 AGGAAGATCTGAAGCAAGCATGG - Intronic
1103053700 12:117802277-117802299 AGGGAAAGAGGAAGGCAGGAGGG - Intronic
1103605813 12:122085274-122085296 AGTCAAAGGTGAAGACAGCAGGG - Intronic
1103991207 12:124800547-124800569 AGGGAAGGCAGAAGCAAGCGTGG + Intronic
1104861855 12:131928194-131928216 AGGGAAAGCAGGAGACAGGAGGG + Intergenic
1105225693 13:18429523-18429545 AGGGGAAGCTGTAGGCAGTAGGG - Intergenic
1105455817 13:20540251-20540273 ACTGAGAGGTGAAGCCAGCAGGG - Intergenic
1105707108 13:22974811-22974833 AGGGAAATCTGAATTCAACATGG - Intergenic
1108240036 13:48454742-48454764 AGGGCAAGCTGATGCTAGCTAGG + Intronic
1108704379 13:52972035-52972057 AGGGAAAGCTTAAGGGAGGAAGG + Intergenic
1108817815 13:54313269-54313291 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
1110079273 13:71290356-71290378 AGTGAGAGGTGAAGCCAGCTGGG - Intergenic
1110836697 13:80091918-80091940 ATGGAAAGCAGAAGAAAGCAGGG - Intergenic
1111197522 13:84894591-84894613 AGTGAGAGGTGAAGCCAGCTGGG - Intergenic
1112201383 13:97279306-97279328 AGAGAAAACTGAAGCCAACGAGG - Intronic
1112306022 13:98274377-98274399 AGGGAAATCTGAACTCAGTAAGG - Intronic
1112384193 13:98922570-98922592 AGGGAAAGGTGAATAAAGCAAGG + Intronic
1112427048 13:99312023-99312045 AGGGAAAACTCCAGCCAGTAAGG - Intronic
1113249688 13:108438231-108438253 AGGAAGAGCTGAAGGAAGCAGGG - Intergenic
1114010145 14:18357874-18357896 AGGGGAAGCTGTAGACAGTAGGG - Intergenic
1114709805 14:24766826-24766848 GGAGAAAGCTGAAGCCCCCAGGG - Intergenic
1115405104 14:33006214-33006236 AGGCAAAGCTGAAGGGAGAAAGG + Intronic
1115904244 14:38189362-38189384 AGGGAATGCTGAAGTCATGAAGG + Intergenic
1117305767 14:54471740-54471762 AGGGAAAGAAGATGCCAGCTGGG - Intergenic
1117516678 14:56508825-56508847 AGAGAAAGCTGTAGCCAGGGAGG + Intronic
1117707426 14:58485762-58485784 AGGGAAAGATGAAGACAGCAGGG - Intronic
1117723067 14:58646194-58646216 GGGGAAAGCTGTAGACAGCAGGG - Exonic
1119546133 14:75472891-75472913 AGGGAATGATGCATCCAGCATGG - Intronic
1121866297 14:97365818-97365840 AGGGAATGCAGAAGCCAAAAGGG - Intergenic
1122971889 14:105155644-105155666 AGGCACAGCTGCAGCCAGCCTGG + Intronic
1123095747 14:105766280-105766302 AGGGACAGGTGAGGACAGCATGG + Intergenic
1124146309 15:27128494-27128516 AGGTTGAGCTGCAGCCAGCATGG + Intronic
1124223492 15:27869866-27869888 AGGGAGAGGTGGAGCCAGCTGGG + Intronic
1124357078 15:29003685-29003707 AGGCAAGCCTGAAGCCCGCAGGG + Intronic
1124598816 15:31114110-31114132 AGTGAGAGGTGAAGCCAGCTGGG - Intronic
1124626851 15:31312576-31312598 AGGGAGAGCAGAAGGCAGCAAGG + Intergenic
1127048684 15:55056565-55056587 AGGGAAACCTTTAGCCAGAAAGG + Intergenic
1127489109 15:59445397-59445419 AAAGCAAGCTGAAGCCACCAGGG - Intronic
1127642185 15:60926329-60926351 ATGGAAAGCTGTAGACAGCCAGG - Intronic
1127758622 15:62116602-62116624 AGGTAAAGATGAAGTCAGGATGG - Intergenic
1128504180 15:68254802-68254824 GGGAAAAGCTGAAGCTGGCAAGG + Intronic
1128995929 15:72294685-72294707 AGTGAAAGCAAAAGCCAGCACGG + Intronic
1130533504 15:84766212-84766234 AGGGCAAGAGGAAGACAGCAAGG - Intronic
1131109918 15:89758673-89758695 AGAGCAAGCTGAGGCCAGCATGG + Intergenic
1131154521 15:90066856-90066878 TGGGAAGACTGAGGCCAGCAAGG + Intronic
1131506635 15:93025493-93025515 AGGCAACACTGATGCCAGCATGG + Exonic
1131516179 15:93078607-93078629 GTGGAAAGATGAAGCCAGAAAGG - Intronic
1133322608 16:4923537-4923559 AGGTACAGCTGAAGACATCAAGG - Intronic
1133480665 16:6167343-6167365 AAGGCAAGCTGAAGCCAGGCTGG - Intronic
1133502058 16:6375966-6375988 AGGGGGAGCTGGAGGCAGCAGGG - Intronic
1133682335 16:8131499-8131521 AGGCAAAGGGGAAGCAAGCATGG - Intergenic
1133834187 16:9351642-9351664 AGTCACACCTGAAGCCAGCATGG + Intergenic
1134244910 16:12532798-12532820 TGCGAAAGCTGAAGACAGCCTGG + Intronic
1134396923 16:13873752-13873774 ATGAATAGCTGAAGCCAGCCAGG + Intergenic
1135269592 16:21057660-21057682 AGAGAAAGCTGAAGGCAGGACGG + Intronic
1135297062 16:21289695-21289717 AGTGAGAGTTGAAGCCAGCTGGG + Intronic
1135400276 16:22162324-22162346 AGGGGAAACTGAAGCCAGTAGGG - Intergenic
1136242467 16:28952496-28952518 TGGGAACACTGGAGCCAGCAGGG + Intronic
1136360393 16:29775697-29775719 AGGGAAAGATGAAGACATAAAGG + Intergenic
1137471294 16:48761028-48761050 AGGGAAAGCAAAAGAAAGCAGGG + Intergenic
1137572284 16:49574736-49574758 AGGGAAAGCAGGAGGGAGCAGGG - Intronic
1137810086 16:51344295-51344317 AGGGAAAGCTGATGACAGCTTGG - Intergenic
1138205376 16:55120534-55120556 AGGAATAGATGAAGACAGCAGGG + Intergenic
1138226407 16:55299278-55299300 AGGGAAGACAGGAGCCAGCAGGG - Intergenic
1138526973 16:57614484-57614506 AGGGAAATCAGGAGCCAGGAGGG + Intronic
1139393177 16:66618931-66618953 AATGTGAGCTGAAGCCAGCATGG - Intronic
1139579369 16:67863284-67863306 AGGAAAATCTAAAGCAAGCAGGG - Intronic
1139673671 16:68508832-68508854 TGGGGAAGCTGTGGCCAGCAGGG - Intergenic
1140050898 16:71480126-71480148 AGGTAGAGTTGAGGCCAGCAGGG - Intronic
1140649125 16:77067312-77067334 AGGCGAAGAGGAAGCCAGCAAGG + Intergenic
1140727785 16:77829449-77829471 AAGGAAACCTGAATACAGCATGG + Intronic
1141308968 16:82894733-82894755 TGGGAAGGCTGTAGCTAGCATGG + Intronic
1141810333 16:86371624-86371646 AGGGAAGGCAGGAGCCAGCAAGG - Intergenic
1141859551 16:86707030-86707052 TGGGGAAACTGAGGCCAGCAGGG - Intergenic
1142135294 16:88449246-88449268 ATGGAAGGGTGAAGCCAGCGGGG - Intergenic
1142141666 16:88475407-88475429 AGGAGAAACTGAGGCCAGCAAGG + Intronic
1142260878 16:89041974-89041996 AGGGCATGCTGAGGCCAGGACGG - Intergenic
1142260922 16:89042094-89042116 AGGGCATGCTGAGGCCAGGACGG - Intergenic
1142260937 16:89042134-89042156 AGGGCATGCTGAGGCCAGGATGG - Intergenic
1142260952 16:89042174-89042196 AGGGCATGCTGAGGCCAGGACGG - Intergenic
1142263293 16:89052331-89052353 AGGGAGGGCTGAATCCCGCAGGG - Intergenic
1142402972 16:89870692-89870714 AGGGAGAGCAGAGGCAAGCAGGG - Exonic
1144320087 17:14107599-14107621 GGTGAAAGCTGAGGCCAGCCAGG - Intronic
1144848228 17:18231051-18231073 AGGGACACCTGAAGGCTGCAGGG - Intronic
1145754831 17:27382760-27382782 AGGGAGAGCAGAATCCAGCTTGG + Intergenic
1146053725 17:29570890-29570912 AGGGGGAGCTGATGCCAGCTGGG - Intronic
1146483716 17:33226497-33226519 AATGAAGGCAGAAGCCAGCAAGG + Intronic
1146758487 17:35454595-35454617 AGGAAAGGCTGATGGCAGCATGG - Intergenic
1147247344 17:39131131-39131153 TGGGAAATGTGAAGCTAGCAAGG + Intronic
1147565879 17:41536240-41536262 AGGGACAGCTGAGTCCTGCAAGG + Intergenic
1147958468 17:44151297-44151319 AGGGGAAGCTGGAGCTAGCTGGG - Intronic
1148460118 17:47834951-47834973 GGGGAAAGTTGAAGCGAGCTGGG - Intronic
1148610148 17:48959720-48959742 AGGGAAAGCTGAGAACAGGATGG + Intronic
1148685750 17:49500214-49500236 AGGGAAGGGTGCAGCCACCATGG + Intronic
1149537141 17:57441841-57441863 AGGCAAAGATGATGCCTGCAGGG + Intronic
1153071962 18:1116382-1116404 AGTGAGAGGTGAAGCCAGCTGGG - Intergenic
1153225745 18:2898359-2898381 AGGGGAAGCTAAAGCCAGCTGGG - Intronic
1153932489 18:9890622-9890644 AGTAAAAGCTGAAGCCATAATGG + Intergenic
1154527685 18:15309998-15310020 AGGGGAAGCTGTAGGCAGTAGGG + Intergenic
1155339585 18:24800327-24800349 AGGGAATGAAGAATCCAGCATGG + Intergenic
1155380588 18:25218079-25218101 AGGGAAAGCCGAAACCTGAAGGG + Intronic
1155403829 18:25466335-25466357 AGGGAAAGCTGAGGACAAAAGGG + Intergenic
1156313048 18:35942332-35942354 AGAGGAAGCTCAACCCAGCAGGG - Intergenic
1156410082 18:36819591-36819613 AGGGAGAGCAGAAGCCACCTGGG + Intronic
1157394337 18:47329311-47329333 AGGGCAAGATGCATCCAGCACGG + Intergenic
1158388444 18:57021331-57021353 ATGAATAGCTGAAGCCAGCGAGG - Intronic
1158974278 18:62696733-62696755 AGGGAAGGATGGAGGCAGCAAGG - Intergenic
1159127205 18:64237609-64237631 GAGCAAAGCTGAAGTCAGCAGGG - Intergenic
1160320853 18:77893522-77893544 AAGGAGAGCAGAAGCCAGGAGGG - Intergenic
1161041642 19:2113587-2113609 AGCGAAAGCCAGAGCCAGCAGGG - Intronic
1161302274 19:3548415-3548437 TGGGGAAACTGAGGCCAGCACGG - Intronic
1162036035 19:7940059-7940081 AGAGAAAGCTGCATCCAGCCTGG + Intronic
1163022602 19:14491233-14491255 CGGCCAAGCTGAATCCAGCATGG - Intronic
1163561602 19:18022529-18022551 AGGGAAGGCTGAAGGCTGGAGGG + Intergenic
1163609319 19:18292829-18292851 AGGGGAAGCTGAAGCAGGAAGGG - Intergenic
1163738993 19:18999232-18999254 GAGGAAAGCTGCAGCCACCACGG + Intronic
1164032417 19:21419508-21419530 AGGGAAGGAAGAATCCAGCACGG + Intronic
1164711461 19:30359824-30359846 AGAGAAAGCTTCAGTCAGCATGG - Intronic
1164768987 19:30793406-30793428 AGGGAGGGGTGCAGCCAGCAGGG - Intergenic
1166218906 19:41353158-41353180 AGGGAAAGCTGAGGTCCTCAGGG + Exonic
1166344194 19:42155181-42155203 AGAGAAAGATGAAGGCAGCCGGG - Intronic
1166603154 19:44115756-44115778 AGGGAAAGCAGAATCCTGCCTGG - Exonic
1166684613 19:44788867-44788889 AGGGGAAACTGAGGCCAGAAAGG + Intronic
1167790553 19:51676235-51676257 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
1168440137 19:56357932-56357954 ATGGAAAGCAGAAACAAGCAGGG + Intronic
925164824 2:1709507-1709529 AGGGACAGCCGGAGCCAGCTTGG + Intronic
927083669 2:19654162-19654184 GAGGAAACCTGAAGCTAGCAGGG + Intergenic
927139197 2:20118248-20118270 AGGGACAGCTGTTTCCAGCAGGG - Intergenic
928126705 2:28621317-28621339 AGGTGGAGCTGGAGCCAGCAGGG - Intronic
928690896 2:33797497-33797519 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
929359250 2:41064382-41064404 AGGGAAAGCTTAAACCCACAGGG + Intergenic
929812839 2:45206290-45206312 AGGGAAAGATGAAACCAAGATGG + Intergenic
929931176 2:46256646-46256668 AGTGAGATCTGAAGACAGCAAGG - Intergenic
930536931 2:52654825-52654847 TGGGAAGGCTGATGGCAGCATGG + Intergenic
930552235 2:52850647-52850669 ATGGAAAGCAGAAGAAAGCAGGG - Intergenic
931348991 2:61471340-61471362 AGGGAAACGCGAAGCCAGCGCGG + Intergenic
931549199 2:63424202-63424224 AGACAAAGCTTCAGCCAGCATGG + Intronic
931587376 2:63842403-63842425 AGGCAAAACTAAACCCAGCAGGG - Intronic
931909393 2:66880428-66880450 AGAGCAAGCTGAAGCCAGGAAGG - Intergenic
931986223 2:67744937-67744959 AGGGTGAGCTGAAGCAAGGAAGG - Intergenic
932262553 2:70338801-70338823 GGGGAAAACTGAAGCCAAGAAGG - Intergenic
933322290 2:80792145-80792167 AGGGAAGGCTGAAGGAAGGAAGG + Intergenic
933534560 2:83556127-83556149 ATGGAAAGCAGAAGTAAGCAGGG - Intergenic
933774845 2:85765723-85765745 AGGGAAGGCAGAAGCCAGCGTGG + Intronic
934573454 2:95385750-95385772 AGGGAAAGCTGATGCCCTCCTGG - Exonic
934649941 2:96085006-96085028 AGGGGAAGCTCAAGCCACCAGGG + Intergenic
934715917 2:96543254-96543276 GGGGGAATCTGAAGCCAGAATGG - Intronic
934786665 2:97014365-97014387 AGTGAGAGGTGAAGCCAGCTGGG + Intronic
935131520 2:100264652-100264674 AGGGAAAGATGGAGGCAGGAGGG - Intergenic
937173426 2:119901392-119901414 AGGGAAACCTGAAGACAGCAAGG + Intronic
937338402 2:121075960-121075982 AGGAAAGGCTGCAGCCAGGAAGG - Intergenic
937428901 2:121821859-121821881 TGGGAAAGCAGAAGCCCCCAGGG - Intergenic
938501100 2:131831665-131831687 ACCGACAGCTGCAGCCAGCAAGG - Intergenic
938512642 2:131966709-131966731 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
938526779 2:132141455-132141477 AGGGGAAGCTGTAGGCAGTAGGG + Intergenic
939278634 2:140034631-140034653 AGGGGAAGATGAAACCAGAAAGG - Intergenic
939410228 2:141815329-141815351 AGTGAGAGGTGAAGCCAGCTGGG + Intronic
940013866 2:149082982-149083004 CAGGAAACCTGATGCCAGCATGG + Intronic
940171661 2:150835284-150835306 TGGAAAAGCTGATGGCAGCATGG + Intergenic
940528284 2:154844921-154844943 AGGGCGAGCTGAAGCAGGCAGGG - Intronic
943624144 2:190180502-190180524 AATGAAAGCAGAAGCCAGCGAGG - Intronic
943645883 2:190408042-190408064 AGGGACACCTGAACCCAGCCGGG - Intergenic
944855094 2:203759814-203759836 AGTCACAGCAGAAGCCAGCATGG + Intergenic
945551732 2:211229136-211229158 AGTGACACCTGAAGCCAGCATGG - Intergenic
945641833 2:212441255-212441277 TGGAAAAGCTGATGACAGCATGG - Intronic
946189974 2:218003009-218003031 AGGGTGAGCTGGAGGCAGCAGGG - Intergenic
946781470 2:223196293-223196315 GGGGAAAGCTGAGGCCAACCTGG - Intronic
947085649 2:226448947-226448969 AGAGAAAGATGCAGCCAACAAGG - Intergenic
947204278 2:227646008-227646030 TGGGGAAGCTGAGGCCAGGAGGG - Intergenic
947579087 2:231300901-231300923 AGGGAAGGGTGTGGCCAGCAGGG + Intronic
948237671 2:236402594-236402616 AGGGGGAGCTGCAGCCAGCGGGG + Intronic
948262213 2:236612851-236612873 AGGGCAAGCCCAAGCCAGCTGGG - Intergenic
948280064 2:236740282-236740304 AGAGAAAGCAGAAGCCAGTGTGG + Intergenic
948461976 2:238134214-238134236 AGGGACAGCCGGAGCCAGGAGGG - Intergenic
948603229 2:239119330-239119352 AGGGAGAGCAGCAGCCAGGACGG + Intronic
1168830214 20:841563-841585 AGGGAGAGCAAAAGCCAGCCTGG + Intronic
1169464823 20:5827738-5827760 AGGGAAATCTGCAGAGAGCAAGG - Intronic
1169692210 20:8344550-8344572 AAGGAAGGCTGAAGCCACAAAGG - Intronic
1170419909 20:16182570-16182592 AGGGAAAGAGAAAGCCGGCAGGG - Intergenic
1170634650 20:18093655-18093677 CAGGAACGCTGAAGCCAGAACGG + Intergenic
1172006064 20:31819830-31819852 AGGAAAATGTGAAGCCACCAGGG + Intronic
1172447806 20:35002280-35002302 AGGGAAGGCTGAAGGCAGCAGGG - Exonic
1172875335 20:38160689-38160711 ATGGAAGGCTGAAGCTAGCTGGG + Intronic
1175384085 20:58583176-58583198 AGGAAAGGCTGGGGCCAGCAGGG + Intergenic
1176046834 20:63097190-63097212 AGGGACAGCTGAGGCCAGGGTGG + Intergenic
1176063480 20:63182404-63182426 AGGGGAAGCTGAGGCCAGGGTGG + Intergenic
1176363992 21:6021586-6021608 AGGGCAGGCTGCAGCCGGCAGGG + Intergenic
1176769746 21:13058546-13058568 AGGGGAAGCTGTAGGCAGTAGGG - Intergenic
1177960965 21:27665460-27665482 AGGGAAAGAACAACCCAGCATGG - Intergenic
1178300050 21:31445289-31445311 ACAGAAGGTTGAAGCCAGCAGGG - Intronic
1178608068 21:34056483-34056505 ACGGGAAACTGAGGCCAGCAAGG - Intergenic
1179566913 21:42254735-42254757 AGAGAAAGCTCAAGGCAGAAAGG - Intronic
1179759526 21:43516959-43516981 AGGGCAGGCTGCAGCCGGCAGGG - Intergenic
1179998140 21:44983374-44983396 AGGGAAGGCTGAAACAAGCCAGG - Intergenic
1180434643 22:15288683-15288705 AGGGGAAGCTGTAGACAGTAGGG - Intergenic
1180516853 22:16152489-16152511 AGGGGAAGCTGTAGGCAGTAGGG - Intergenic
1180832926 22:18915201-18915223 GGGCAGAGCTGAAGCCTGCAGGG + Intronic
1180984019 22:19893541-19893563 AGGGGCAGCTGGAGCCAACAGGG - Intronic
1181066895 22:20311051-20311073 GGGCAGAGCTGAAGCCTGCAGGG - Intergenic
1182005374 22:26955320-26955342 AGGATAAGCAGAAGCCAGCCAGG - Intergenic
1182017404 22:27052319-27052341 TGGGGGAGCTGAAGGCAGCAGGG - Intergenic
1182346046 22:29665835-29665857 AGGGAAAGGAGAGACCAGCAGGG - Intronic
1182422406 22:30254806-30254828 TGGGGATGCTGAGGCCAGCAGGG - Intergenic
1183105315 22:35611117-35611139 AGGGAAGGCTGGAGTCGGCATGG + Intronic
1183329092 22:37209815-37209837 TGGGAAAGCGGATGCCAGCTGGG - Intronic
1183581953 22:38731543-38731565 AGCGAAAGCTGAGGGCAGCCAGG - Exonic
1184362665 22:44027497-44027519 AGAGACAGCTGAAGGCAGCGGGG + Intronic
1184460563 22:44635394-44635416 AGGCAACTCTGCAGCCAGCATGG + Intergenic
1184642782 22:45881046-45881068 AGAGAATGCTGGAGCCAGCCGGG + Intergenic
1184805535 22:46792873-46792895 GGGGAAAGGACAAGCCAGCATGG - Intronic
1184957424 22:47900087-47900109 AGGGAAACCTGAGGCCACCGAGG - Intergenic
1185165847 22:49261709-49261731 AGGGGAAGCTGAAGCCCGTGGGG - Intergenic
949242275 3:1887291-1887313 TAGGAAAACTCAAGCCAGCAGGG + Intergenic
949411929 3:3775016-3775038 AGGGAATGTTGTGGCCAGCATGG - Intronic
950392645 3:12708707-12708729 AGGGAAAGCCAAATCCAGCTAGG + Intergenic
950404655 3:12797036-12797058 AGGTAGGGCTGAAGCCTGCACGG - Intronic
950632341 3:14290881-14290903 AGAAAAACATGAAGCCAGCATGG + Intergenic
951390672 3:22099731-22099753 AAGGAGAGCTGAAGCCAGCAAGG + Intronic
951578307 3:24135667-24135689 AGGGATATCTGAAGGCTGCAGGG - Intronic
952407406 3:33016768-33016790 AGGGAAAGCTGGAGCCACTCTGG - Exonic
953136393 3:40185829-40185851 AGGAGAAGCTGTAGACAGCAGGG + Intronic
953381593 3:42476608-42476630 AGGCATAGCTGAAGCCACCATGG + Intergenic
954386615 3:50247388-50247410 AGGGGAAACTGAAGCCAGAAAGG + Intronic
954604682 3:51900167-51900189 AAGGAAAACTGCAGCCAGCCTGG + Intronic
955445449 3:59005202-59005224 AAGGAAAACAGAAGCCACCAAGG - Intronic
955744201 3:62124246-62124268 AGGGAATTCAGAAGCCTGCAAGG + Intronic
956374993 3:68604470-68604492 AGGGAAAGCAGAAAAAAGCAGGG + Intergenic
956512754 3:70012389-70012411 AGGGAAAGAGGAAGCCATGAGGG + Intergenic
957278284 3:78116905-78116927 AAGAAAAACTGAAGCCAGGAAGG - Intergenic
957370454 3:79287687-79287709 GGGGAAAACTGAAGCAAGTAAGG - Intronic
958601008 3:96297544-96297566 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
958663902 3:97108883-97108905 ATGGAAAGCTGGAGCAAGAATGG - Intronic
958900793 3:99884162-99884184 GGGAAAAGCTCAAGCCAGAATGG + Intronic
959247964 3:103899669-103899691 AGTGACAGGTGAAGCCAGCTGGG - Intergenic
959267336 3:104158971-104158993 AGGAAATTCTGAAGTCAGCAGGG + Intergenic
960495073 3:118363327-118363349 AGGGAAGGCTGATGGCAGCATGG + Intergenic
960707331 3:120493726-120493748 AGGGAAAGCTCAAACCAACCTGG + Intergenic
960863836 3:122180812-122180834 AGAGAAAGATGATGCCAGCTTGG + Intergenic
961467724 3:127091649-127091671 AGGGAGAGAGGAAGACAGCAAGG + Intergenic
962106641 3:132396615-132396637 AGTGAAAGGTGAAGCCGGCTGGG + Intergenic
962241302 3:133753441-133753463 AGAGTCAACTGAAGCCAGCAGGG + Intronic
963049332 3:141128083-141128105 AGGGAAACCTGGAGGCCGCAGGG - Intronic
963264428 3:143226841-143226863 AAGGGAAGCTGAAGCTGGCAGGG + Intergenic
963530519 3:146469234-146469256 AGGGGAAGCTGAGCCCCGCAAGG + Exonic
963537206 3:146544131-146544153 AGGGGAAGCTGAGCCCCGCAAGG + Intronic
964258939 3:154811678-154811700 AGTCACAACTGAAGCCAGCATGG + Intergenic
964312060 3:155404355-155404377 GGGCATAGCTGAAGCCAGGAAGG - Intronic
964339081 3:155689016-155689038 GGTGAGACCTGAAGCCAGCATGG - Intronic
964450809 3:156810844-156810866 AGGGAAAGCGCGAGCAAGCAAGG + Intergenic
965319113 3:167229623-167229645 TAAGAAAGCTAAAGCCAGCATGG - Intergenic
965379248 3:167967480-167967502 AGTCACAGCTGAAGCCAGAATGG - Intergenic
966637999 3:182157001-182157023 AGGGCAAGCTGAAGCAAGGTGGG - Intergenic
966903663 3:184506331-184506353 AGCAAAAGCTGAAACCAGAAGGG - Intronic
967097310 3:186187588-186187610 AGGGAAAGCTGGAGACAGGCTGG + Intronic
967118282 3:186361430-186361452 AAGGGAAGCTGAAGCGAACACGG - Intronic
968008063 3:195256279-195256301 AGGAAAAGCAGGATCCAGCATGG + Intronic
968479637 4:827420-827442 AGGGAAGGGTGAAGGCACCAGGG + Intergenic
968543257 4:1178952-1178974 AGAGAAACCTGAATCCAGAATGG - Intronic
969047705 4:4349126-4349148 AGTGAGAGGTGAAGCCAGCTGGG - Intronic
969105523 4:4804616-4804638 AGGGAACACTTAAGCCAGTATGG + Intergenic
969127529 4:4963675-4963697 AGGGAAAGCAGTAGCCCACATGG - Intergenic
969854898 4:9991185-9991207 GGGGAAAGCAGAAAGCAGCAGGG - Intronic
970418890 4:15886481-15886503 TGAGAAAACTGAAGCCATCATGG + Intergenic
970746637 4:19306188-19306210 AGGGAAACCTGAAGAAAACAAGG - Intergenic
970997081 4:22279919-22279941 ATGAAGAGATGAAGCCAGCAAGG + Intergenic
971322097 4:25613948-25613970 AGTGAGAGGTGAAGCCAGCTGGG - Intergenic
971793847 4:31201694-31201716 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
971798601 4:31259552-31259574 AGTGAGAGGTGAAGCCAGCTAGG + Intergenic
973046708 4:45542431-45542453 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
973121349 4:46523807-46523829 TGGGAAAGCTGATGGCAGCATGG + Intergenic
973968526 4:56187865-56187887 ACAGAAAGCTAAAGTCAGCATGG + Intronic
974475334 4:62371913-62371935 TAGGAAAGTTGAAGCCATCAAGG - Intergenic
974479357 4:62423425-62423447 TGGGAAGGCTGATGGCAGCATGG + Intergenic
974636584 4:64571443-64571465 AGAGTAATCTGATGCCAGCAAGG + Intergenic
975047603 4:69824561-69824583 AGTGAGAGGTGAAGCCAGCCGGG + Intronic
975844065 4:78506722-78506744 AGGGCAAGCTGAAGCAGGGAGGG - Intronic
976862358 4:89680626-89680648 AGTGAGAGGTGAAGCCAGCTGGG - Intergenic
977465659 4:97380839-97380861 GTGGAAAGCTGATGGCAGCATGG - Intronic
977528188 4:98169230-98169252 CAGGAAAGCTGAAGTAAGCATGG + Intergenic
977559931 4:98521684-98521706 AGGGCAAGCTGAAGCAAGCCAGG - Intronic
977918726 4:102621152-102621174 GGGGAAAGATCCAGCCAGCATGG + Intergenic
978702102 4:111660042-111660064 ATGGAAAGAAGAATCCAGCACGG - Intergenic
979281935 4:118878460-118878482 AGGGAGAGGTGAAGCCAGCTGGG + Intronic
980438856 4:132815275-132815297 AAGGAAAACTGGAGCCAGCCTGG - Intergenic
981315803 4:143337997-143338019 GGGGACAGCTGAAGCCAGAAGGG + Intronic
981601505 4:146494202-146494224 GGGGAAACCAAAAGCCAGCAAGG + Intronic
981726189 4:147849928-147849950 AGTGAGAGGTGAAGCCAGCTGGG + Intronic
982032681 4:151316404-151316426 AAGGAAATCTGAATCAAGCATGG + Intronic
982526866 4:156489847-156489869 TGGAAAAGCTGATGGCAGCATGG - Intergenic
983319807 4:166181532-166181554 AGGGAATTTTGAAGCCAGTAGGG + Intergenic
983421653 4:167526444-167526466 AGTCAAACCTGAAGCCAGAATGG + Intergenic
983708321 4:170685831-170685853 AAGGAAAACTCAAGCCAGCCTGG + Intergenic
983957796 4:173717630-173717652 AGTGAGAGGTGAAGCCAGCTGGG - Intergenic
984061397 4:174992374-174992396 TGAAAAAGCTGATGCCAGCACGG + Intergenic
984121875 4:175755932-175755954 AGAGAAAACTGAAGACAGAAAGG + Intronic
984834568 4:184007800-184007822 GGGGAAAGCTGGAGACAGAAAGG - Intronic
986338478 5:6771668-6771690 AGGGAAAGGTTAAGTCAGGACGG - Intergenic
986535166 5:8779066-8779088 AGGCAAAACTTAAGACAGCAAGG - Intergenic
986600264 5:9466064-9466086 AGGGTAATGTCAAGCCAGCAAGG + Intronic
986751103 5:10788538-10788560 ATGGACAGCAGAGGCCAGCAGGG - Intergenic
987304316 5:16623446-16623468 AGAGAAAGCTGAAGAAAGCAGGG - Intergenic
988133982 5:27144801-27144823 AGGGTCAGTTGAAGCCTGCATGG + Intergenic
989757682 5:44975313-44975335 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
989760239 5:45007151-45007173 AGGGAGAAGTGAAGCCAGCTGGG + Intergenic
989760503 5:45010206-45010228 AGTGAGAGGTGAAGCCAGCTGGG - Intergenic
990839134 5:60055926-60055948 AGGGAAAGGAGAAGCAAGGAAGG + Intronic
991945795 5:71897574-71897596 TGGGAAGGCTGATGGCAGCATGG - Intergenic
992149971 5:73893245-73893267 GAGGAAAGCTGAAGCCAGAGTGG + Exonic
992426393 5:76662275-76662297 AGGCAATGCTGAACCCAGAAAGG - Intronic
992923176 5:81549251-81549273 AGAGAAAGATGAAGGCAGGAAGG - Intronic
993375279 5:87143209-87143231 AGGGGCAGCTGAATCCAGCAGGG - Intergenic
993622487 5:90185548-90185570 AAGTAAAGTTGAAGCCAACATGG + Intergenic
994245442 5:97471335-97471357 AGGGAAGGCTGAAGACAGCCTGG - Intergenic
994751817 5:103747511-103747533 AGGAAAAACAGAAGCCATCATGG - Intergenic
995230639 5:109757693-109757715 AGGGAAGGGTGAAGCTAGGAAGG - Intronic
995332853 5:110964998-110965020 AAGGAGAGTTGAAGCCAGGAAGG + Intergenic
995434523 5:112120534-112120556 AGGGAAATGTGAAGTAAGCAAGG + Intergenic
996680002 5:126221221-126221243 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
996987580 5:129585191-129585213 AGGGCAAGCAGAAGCGGGCAGGG - Intronic
997658860 5:135575069-135575091 GGAGAAAGCTAATGCCAGCAAGG + Intronic
998178167 5:139914805-139914827 AGGGCAAGCTGAGCCCAACATGG - Intronic
998552542 5:143091258-143091280 AAGGAAAACTCAAGCCAGCCTGG - Intronic
999075767 5:148793700-148793722 AAGGAAAGGTGAAGCCAGGGAGG - Intergenic
999158342 5:149474429-149474451 AGGGAATGCTGGAGCCACCTGGG - Intergenic
999397351 5:151238491-151238513 AGGGTGAGCTGGAGGCAGCAGGG - Intronic
999503458 5:152170143-152170165 ACAGAAAGCTGCAGGCAGCAAGG - Intergenic
1000099053 5:157997200-157997222 AGGGAAAGATGAAGGAAGAAAGG - Intergenic
1000364135 5:160475366-160475388 GAGGAAAGCTGGAGCTAGCATGG - Intergenic
1000392772 5:160742671-160742693 AAGGAAAGCTGAATAGAGCAGGG + Intronic
1000902646 5:166928369-166928391 AGGGAAATCTAAAGGTAGCATGG + Intergenic
1001558497 5:172653026-172653048 AAGGAAAACTCAAGCCAGCCTGG - Intronic
1001907712 5:175486822-175486844 AGGGCAAGCTGCCGCCATCACGG - Intronic
1002123999 5:177027940-177027962 AAGAAAAGCCGAAGCCAGCTGGG - Intronic
1002553982 5:180019972-180019994 ACGGAGAGGTGAAGCCAGGAGGG + Intronic
1002794659 6:462941-462963 AGTGAAAGCTAAAGCAGGCAAGG + Intergenic
1003721825 6:8711665-8711687 AGAGAAAGCTAATGCCAGAAAGG - Intergenic
1003832803 6:10033217-10033239 GGGGAAGGCTGAGCCCAGCAGGG + Intronic
1004415884 6:15423767-15423789 AAGGGAAGCAGAGGCCAGCAAGG - Intronic
1005575249 6:27184038-27184060 AGGGAAAGCTCGAACCAACATGG + Intergenic
1006937402 6:37728019-37728041 AGGGAAAGATGGAGCAAGAAAGG + Intergenic
1007077313 6:39075978-39076000 GGAGAAAGATGAAGCCAGCAGGG + Intronic
1007325279 6:41054730-41054752 AGGGAAAGCCTAAGGCAGCCTGG + Intronic
1007448603 6:41926051-41926073 TGGGAAAGGTGAAGCCAGACTGG - Intronic
1007791951 6:44314587-44314609 ACAGAAAGCTAAAGCCAGCTGGG + Intronic
1008123420 6:47643637-47643659 AAGGAAAACTCAAGCCAGCCTGG + Intergenic
1008561106 6:52725523-52725545 ATTGAAAGATGAGGCCAGCATGG - Intergenic
1008676157 6:53821241-53821263 AGAGAAAGCAGATGCTAGCAAGG - Intronic
1009301719 6:62031938-62031960 GGTCAAACCTGAAGCCAGCAAGG - Intronic
1009390445 6:63137624-63137646 TGGGAAGGCTGATGGCAGCATGG + Intergenic
1009672962 6:66779964-66779986 AGTGAGAGGTGAAGCCAGCTGGG - Intergenic
1009688219 6:66991081-66991103 AGTGAGAGGTGAAGCCAGCTTGG + Intergenic
1010039234 6:71361626-71361648 AGGGCAAGCTGAAGCAAGGTGGG - Intergenic
1010064739 6:71669050-71669072 AAGGAAATCTGAATCCAGTACGG - Intergenic
1010412018 6:75571235-75571257 ATGGAAAGCTGAAAAGAGCAGGG + Intergenic
1010727741 6:79354521-79354543 GGGGAAAGCTGATGCTGGCAAGG - Intergenic
1010732308 6:79404267-79404289 TTGAAAAGCTGAAGCCACCATGG + Intergenic
1010785374 6:79994031-79994053 AGCTGAGGCTGAAGCCAGCATGG - Intergenic
1012730134 6:102871769-102871791 AGGAAAGGCTGATGGCAGCATGG - Intergenic
1012827329 6:104162869-104162891 AGTCACATCTGAAGCCAGCATGG - Intergenic
1013435287 6:110098876-110098898 AGAGAAAGCTAAAGCTTGCAAGG + Intergenic
1014143034 6:117965740-117965762 AGTGAGAGGTGAAGCCAGCTGGG + Intronic
1015002856 6:128241190-128241212 AGAGAAAGATGTAGCCAGTAAGG - Intronic
1016212516 6:141555687-141555709 AGGGAAGGCTGAAACCTACATGG + Intergenic
1017767694 6:157620328-157620350 AGGGGCAGCTGAGGCCATCAGGG - Intronic
1018256373 6:161923843-161923865 AGGGAAAGAGGAAGCCAGGTGGG - Intronic
1018653527 6:166010748-166010770 AGGGAAAGCTGACGGGAGCCAGG + Intergenic
1018734845 6:166679950-166679972 AGTGAGAGGTGAAGCCAGCTGGG + Intronic
1019607935 7:1919346-1919368 AGGGACACCTGCAGCCTGCAAGG + Intronic
1019621199 7:1992913-1992935 AGAAAAAGCTTAAGCCAGAAAGG + Intronic
1020097297 7:5376288-5376310 AGGGGAAGCTGAAGCCAGAGAGG + Intronic
1022450325 7:30507838-30507860 AGTGACAGGTGAAGCCAGCTGGG - Intronic
1022503486 7:30896757-30896779 AGGGAAGGCTGCAGGCAGCCAGG - Intergenic
1023077626 7:36499674-36499696 ATTGAGAGGTGAAGCCAGCAGGG - Intergenic
1023207892 7:37770522-37770544 AGAGAAAGATGAAGACAGAAAGG - Intronic
1023338446 7:39194378-39194400 AGTGAGAGGTGAAGCCAGCTGGG + Intronic
1023454351 7:40322256-40322278 AGGGACCTCTGAAGCCAGAAAGG - Intronic
1026502169 7:70952207-70952229 AGGGAAAGCAGAAGCCCTCTTGG + Intergenic
1026601474 7:71781205-71781227 AGAGAAACCTGAAGCCAGGGAGG + Exonic
1027499281 7:78927908-78927930 AGGGATAGCATAAGCCACCAGGG - Intronic
1030528758 7:110686070-110686092 AGTGAAAACAGAAGCCAGCAAGG - Intronic
1030733138 7:113013871-113013893 AGGGAAACATGATGCCACCAAGG - Intergenic
1031417124 7:121507969-121507991 AGGGAAAGCTCAAGCCCACTTGG - Intergenic
1031730889 7:125299428-125299450 AGTGAGAGGTGAAGCCAGCTCGG - Intergenic
1032858651 7:135858139-135858161 AGGGAGAGCTGAGGACAGCCAGG - Intergenic
1033167624 7:139054431-139054453 CACAAAAGCTGAAGCCAGCATGG + Intronic
1033356974 7:140607844-140607866 AGTGAAAGGGGAAGCCAGCTTGG - Intronic
1033639555 7:143248326-143248348 AGGGAAAGATGAAGGGAGGAAGG - Intronic
1034289603 7:149919011-149919033 AGAGAAGGCTGAAGCCAGGGAGG - Intergenic
1034415981 7:150964466-150964488 AGGGAACGCAGGAGCCACCATGG - Intronic
1034516854 7:151587832-151587854 AAGGAAATCTGAAGAAAGCATGG + Intronic
1034882147 7:154770908-154770930 AGTGAAGCCAGAAGCCAGCATGG - Intronic
1034898089 7:154890371-154890393 AGGGAGAGCTCCAGCCAGAAGGG + Intronic
1035767569 8:2119496-2119518 AGGGACAGCTGGAGGCAGCACGG + Intronic
1036412662 8:8517003-8517025 AGGGAAAGCAGCTGCCAGGATGG + Intergenic
1036789611 8:11709062-11709084 AGGGAAGGCAGAAGCCAGTGCGG + Intronic
1037161775 8:15781460-15781482 AGGGAACTTTGAAGGCAGCAAGG + Intergenic
1037460463 8:19103317-19103339 AGGGAAAGCAGGAGCCAGGCAGG + Intergenic
1037917215 8:22779903-22779925 AGGGAAAGTTAAAAGCAGCATGG + Intronic
1038392412 8:27214834-27214856 AGGGAAACCTAAAGACAGCAGGG + Intergenic
1038686007 8:29719112-29719134 AGGGGAAGCGGAAGGCAGCAGGG - Intergenic
1038788948 8:30649973-30649995 AAGGAAAGCTGAAGCCCAAATGG + Intronic
1038839572 8:31170054-31170076 GGAGAAAGCAGAGGCCAGCAGGG - Intronic
1038873340 8:31520093-31520115 AGGGCAAGCTGAAGCAGGGAAGG - Intergenic
1040983530 8:53269408-53269430 AGGGAAAGCTCAAACCTACATGG - Intergenic
1042026893 8:64433435-64433457 AAGGAAGCCTGAAGCAAGCAGGG + Intergenic
1042150839 8:65781852-65781874 AGAGAAAGATGGAGACAGCAAGG + Intronic
1043394219 8:79821170-79821192 AGGCAAACCTGAGGCCATCAGGG + Intergenic
1044588500 8:93890588-93890610 AGGGAAAGCCAAAGTCAGAAAGG - Intronic
1045363249 8:101452277-101452299 AGGGAAAGGTGAAGACAGCATGG + Intergenic
1045692438 8:104773730-104773752 AAGGAAAGCAGAAGTCATCAAGG - Intronic
1047129320 8:122001414-122001436 AGGGCAAGCTGAAGCAAGGCGGG + Intergenic
1047373525 8:124275518-124275540 AGGGAAGACTGAGGCTAGCAGGG + Intergenic
1047742376 8:127816843-127816865 AAAGGAAGCTGAAGGCAGCATGG - Intergenic
1047894098 8:129345712-129345734 AGCAAAAGCTAAAGCCATCAGGG + Intergenic
1048932545 8:139326452-139326474 AGGCACAGCATAAGCCAGCAAGG + Intergenic
1049379025 8:142302849-142302871 AGGCACAGCGGAGGCCAGCAGGG - Intronic
1050555154 9:6783500-6783522 AAGGACAGTTGAGGCCAGCATGG + Intronic
1050906916 9:11016215-11016237 AGTCACACCTGAAGCCAGCATGG + Intergenic
1053013707 9:34649851-34649873 AAGGACTGCTGAAGCCACCAGGG - Intronic
1053110799 9:35458055-35458077 AAGGAAAACTCGAGCCAGCATGG - Intergenic
1055456578 9:76477877-76477899 AGTGAGAGGTGAAGCCAGCTGGG + Intronic
1056180606 9:84078756-84078778 AGGAAAAGCTGATGCTGGCAAGG + Intergenic
1056273950 9:84974803-84974825 AGGGAAAGCTGAAGCCAGCAGGG - Intronic
1056949396 9:91029882-91029904 AGGGAGAGCTGACGCCCTCACGG - Intergenic
1057064571 9:92037121-92037143 TAGGACAGCTGAAGCCAGCTAGG + Intronic
1058503513 9:105646677-105646699 AGGGAGAACAGAAGCCAGGAAGG + Intergenic
1059440140 9:114301957-114301979 CGGGAAAGCAGAGGCCAGCTTGG + Intronic
1059443537 9:114324342-114324364 AGGCAGATCTGAAGCCAGCCTGG - Intronic
1059444729 9:114331117-114331139 AGGCAGATCTGAAGCCAGCCTGG - Intronic
1059449182 9:114359649-114359671 AGGGAAAGCAGAGGCCACCAGGG - Exonic
1059886645 9:118751686-118751708 GGGTCATGCTGAAGCCAGCACGG - Intergenic
1060010723 9:120040867-120040889 AGGCAAAGCTGGAGGCAGCCGGG - Intergenic
1060726328 9:126008346-126008368 AGGGAAAGGGGAAGCAAGCATGG - Intergenic
1060750016 9:126162833-126162855 AGGGAGGGCTGAAGCCAGGGCGG - Intergenic
1060765598 9:126293384-126293406 AGAGCCAGCTGGAGCCAGCAGGG + Intergenic
1061193356 9:129094725-129094747 AGGGAAAGCTGAAGAGGGCAAGG + Intergenic
1062051844 9:134451485-134451507 ATGGGAAGCTCTAGCCAGCAAGG - Intergenic
1062057658 9:134476924-134476946 AGGGAAAGAAGAAGCCAGATTGG + Intergenic
1062498565 9:136842851-136842873 ACCGACAGCTGCAGCCAGCAAGG + Intronic
1185744966 X:2565292-2565314 AGTGAAAGCTGAGACCAGCGAGG + Intergenic
1185778375 X:2824407-2824429 AGGGGTAGCTGGAGCCAGGAGGG - Intergenic
1186181077 X:6974026-6974048 ATGGAAAGCAGAAAACAGCAGGG - Intergenic
1186670927 X:11766609-11766631 ATGGAAAGTTGATGGCAGCAGGG + Intronic
1186795945 X:13046039-13046061 AGAGAAACCTGAAGCAATCATGG - Intergenic
1187003925 X:15212947-15212969 ATGGAAAGCTGCTGGCAGCATGG - Intergenic
1187908767 X:24091094-24091116 AGGAAAGTTTGAAGCCAGCAGGG - Intergenic
1188827789 X:34857764-34857786 AGGGAAACCTAAAGCCAAAAGGG - Intergenic
1189321263 X:40089012-40089034 AGGGAAAGGGGAACCCAGGAAGG + Intronic
1189613426 X:42762059-42762081 AGGGAAATCTGAAGCTGGGATGG + Intergenic
1189892214 X:45615414-45615436 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
1190548784 X:51557732-51557754 AGGGAAAGCAGAAGTGTGCAAGG + Intergenic
1190659384 X:52640793-52640815 AGGGGAAGCTGCACCCAGAAAGG + Intergenic
1192066690 X:67892120-67892142 AGGCAAGTCTGAACCCAGCAGGG - Intergenic
1192673576 X:73170952-73170974 TGGAAAAGCTGATGGCAGCATGG + Intergenic
1192966305 X:76181106-76181128 ATGGAAAGCAGAAGAAAGCAGGG - Intergenic
1192974127 X:76265571-76265593 ATGGAAAGCAGAAGAAAGCAGGG - Intergenic
1193433223 X:81437994-81438016 AAGGAAGGCTGATGGCAGCATGG + Intergenic
1193880057 X:86910789-86910811 AGTGAGGTCTGAAGCCAGCATGG + Intergenic
1193978916 X:88157637-88157659 TGGAAAGGCTGAAGGCAGCATGG - Intergenic
1194077721 X:89417273-89417295 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
1194326296 X:92521870-92521892 AGAAAACGCTGAAGCTAGCAGGG - Intronic
1194910017 X:99630556-99630578 ATGCAAGTCTGAAGCCAGCAGGG + Intergenic
1195215925 X:102702088-102702110 AGGGAAACCCAAAGGCAGCAGGG + Intergenic
1195315427 X:103672774-103672796 ACAGACAGCTGAAGACAGCAGGG + Intergenic
1196663645 X:118294406-118294428 AGTGAGAGGTGAAGCCAGCTGGG - Intergenic
1198242484 X:134799317-134799339 AGAAAAAGCTGAAAGCAGCAGGG + Intronic
1198678182 X:139153234-139153256 TGGGAAAGCGGAAGCCAGGTTGG - Intronic
1198700909 X:139397325-139397347 TGGAAAAGCTGATGGCAGCATGG - Intergenic
1199717177 X:150515200-150515222 AGGGAAAGCTGCAGCCTGCCTGG - Intergenic
1199795207 X:151188795-151188817 AGGAAAAGCTAAAGACAACAGGG + Intergenic
1200150375 X:153948418-153948440 AGGAAAAGCTGGGGCCAGCCAGG - Exonic
1200430373 Y:3072818-3072840 AGTGACAGGTGAAGCCAGCTGGG + Intergenic
1200635015 Y:5641072-5641094 AGAAAACGCTGAAGCTAGCAGGG - Intronic
1200749344 Y:6930514-6930536 AGTGAGAGGTGAAGCCAGCTGGG + Intronic
1200834352 Y:7718257-7718279 AGGGAAAGCTACAGCTAGCTTGG + Intergenic
1201291563 Y:12425323-12425345 AGGGGTAGCTGGAGCCAGGAGGG + Intergenic
1201403374 Y:13627362-13627384 ACTGAGAGCTGAAGCCAGCTGGG + Intergenic
1201630882 Y:16071028-16071050 AGTGAGAGGTGAAGCCAGCTGGG + Intergenic
1202117422 Y:21483143-21483165 AGGAACAACTGGAGCCAGCATGG - Intergenic