ID: 1056273951

View in Genome Browser
Species Human (GRCh38)
Location 9:84974804-84974826
Sequence TAGGGAAAGCTGAAGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 735
Summary {0: 1, 1: 0, 2: 4, 3: 97, 4: 633}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056273951_1056273964 30 Left 1056273951 9:84974804-84974826 CCTGCTGGCTTCAGCTTTCCCTA 0: 1
1: 0
2: 4
3: 97
4: 633
Right 1056273964 9:84974857-84974879 GGAGTTAAGGGGAGCAGGCCTGG No data
1056273951_1056273952 -10 Left 1056273951 9:84974804-84974826 CCTGCTGGCTTCAGCTTTCCCTA 0: 1
1: 0
2: 4
3: 97
4: 633
Right 1056273952 9:84974817-84974839 GCTTTCCCTAAGCAGCCTCAAGG No data
1056273951_1056273955 0 Left 1056273951 9:84974804-84974826 CCTGCTGGCTTCAGCTTTCCCTA 0: 1
1: 0
2: 4
3: 97
4: 633
Right 1056273955 9:84974827-84974849 AGCAGCCTCAAGGAAGTCGCCGG No data
1056273951_1056273963 25 Left 1056273951 9:84974804-84974826 CCTGCTGGCTTCAGCTTTCCCTA 0: 1
1: 0
2: 4
3: 97
4: 633
Right 1056273963 9:84974852-84974874 GTTTGGGAGTTAAGGGGAGCAGG No data
1056273951_1056273962 19 Left 1056273951 9:84974804-84974826 CCTGCTGGCTTCAGCTTTCCCTA 0: 1
1: 0
2: 4
3: 97
4: 633
Right 1056273962 9:84974846-84974868 CCGGCTGTTTGGGAGTTAAGGGG No data
1056273951_1056273959 17 Left 1056273951 9:84974804-84974826 CCTGCTGGCTTCAGCTTTCCCTA 0: 1
1: 0
2: 4
3: 97
4: 633
Right 1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG No data
1056273951_1056273960 18 Left 1056273951 9:84974804-84974826 CCTGCTGGCTTCAGCTTTCCCTA 0: 1
1: 0
2: 4
3: 97
4: 633
Right 1056273960 9:84974845-84974867 GCCGGCTGTTTGGGAGTTAAGGG No data
1056273951_1056273958 9 Left 1056273951 9:84974804-84974826 CCTGCTGGCTTCAGCTTTCCCTA 0: 1
1: 0
2: 4
3: 97
4: 633
Right 1056273958 9:84974836-84974858 AAGGAAGTCGCCGGCTGTTTGGG No data
1056273951_1056273957 8 Left 1056273951 9:84974804-84974826 CCTGCTGGCTTCAGCTTTCCCTA 0: 1
1: 0
2: 4
3: 97
4: 633
Right 1056273957 9:84974835-84974857 CAAGGAAGTCGCCGGCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056273951 Original CRISPR TAGGGAAAGCTGAAGCCAGC AGG (reversed) Intronic
900001172 1:15669-15691 TAGGGGAAGCAGGGGCCAGCTGG + Intergenic
900407854 1:2500283-2500305 GAGGGCCAGCTGCAGCCAGCAGG - Intronic
900489815 1:2942254-2942276 TAGGGGAAACTGAGGCCAGCAGG - Intergenic
900660003 1:3777520-3777542 GAGGGAAAGGAGTAGCCAGCTGG + Intergenic
900968471 1:5975975-5975997 AAGGGAGAGCTGAAGTCAGAGGG + Intronic
901093828 1:6662461-6662483 TGGTGAGAGGTGAAGCCAGCTGG + Intronic
901793347 1:11666121-11666143 TAGGGAAAGAAGGAGCCTGCTGG - Intronic
901794609 1:11673123-11673145 TAGGGAGCGCTGAAGCCAGCTGG + Intronic
902312077 1:15588733-15588755 TAGTGAGAGGTGAAGCCGGCTGG - Intronic
903006778 1:20303820-20303842 TTGTGATGGCTGAAGCCAGCAGG + Intronic
903468081 1:23566429-23566451 CAGGGATAGCTGTGGCCAGCAGG - Intergenic
904056165 1:27671713-27671735 TAAGGATAGATGAAGCCATCTGG - Intronic
904362129 1:29983033-29983055 TTGTGAGAGGTGAAGCCAGCTGG - Intergenic
904447308 1:30585579-30585601 GAGGGAAAGCTGAAGCAGGGCGG - Intergenic
904849211 1:33444578-33444600 TAGGGAGAGCAGAACCTAGCTGG + Intergenic
905627323 1:39497774-39497796 GAGGGAAAGAGGAACCCAGCAGG + Intronic
905669099 1:39779344-39779366 GAGGGAAAGAGGAACCCAGCAGG - Intronic
906753312 1:48285733-48285755 GAGGGAAAGCTGAAGCTGGGTGG - Intergenic
906766040 1:48435199-48435221 AAGTGAGAGGTGAAGCCAGCTGG + Intronic
906988899 1:50716436-50716458 TACTGAGAGGTGAAGCCAGCTGG + Intronic
907031628 1:51177917-51177939 TAGTGAGAGGTGAAGCCTGCTGG + Intergenic
907496891 1:54851352-54851374 TTGGGAAAGATGAGGCCTGCAGG + Exonic
907793442 1:57691088-57691110 TATTGAGAGGTGAAGCCAGCTGG + Intronic
907841954 1:58167157-58167179 TAATGAGAGGTGAAGCCAGCTGG + Intronic
907943213 1:59108657-59108679 TTGGGAAAGCAGAAGACAGATGG + Intergenic
909442284 1:75710835-75710857 TAGTGACAGCTGAAACCAGAAGG + Intergenic
909604698 1:77496665-77496687 AAGTGAGAGGTGAAGCCAGCTGG + Intronic
909941319 1:81615100-81615122 TATTGAAAGGTGAAGCCGGCTGG + Intronic
910018548 1:82556639-82556661 TAGGGAACGATGACTCCAGCAGG + Intergenic
910688159 1:89939445-89939467 CAGGGAAGGCTGAAGCCAAGGGG + Intergenic
911130136 1:94378766-94378788 TAGTGAGAGTTGAAGCCAGTTGG - Intergenic
911298584 1:96147668-96147690 AACTGAGAGCTGAAGCCAGCTGG + Intergenic
911345376 1:96690683-96690705 TACTGACAGGTGAAGCCAGCTGG + Intergenic
911379616 1:97096481-97096503 TATTGAGAGGTGAAGCCAGCTGG + Intronic
911887918 1:103327130-103327152 TAGGGGAGGGTGATGCCAGCTGG + Intergenic
911992731 1:104722566-104722588 TATTGAGAGATGAAGCCAGCTGG - Intergenic
912082836 1:105958596-105958618 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
912675923 1:111680575-111680597 TGGTGAGAGGTGAAGCCAGCTGG - Intronic
913279541 1:117172715-117172737 TTGTGAGAGGTGAAGCCAGCTGG + Intronic
913297691 1:117337577-117337599 AAGTGAGAGGTGAAGCCAGCTGG + Intergenic
913378921 1:118186796-118186818 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
913699379 1:121359841-121359863 TAAGTAGAGGTGAAGCCAGCTGG + Intronic
914138166 1:144920195-144920217 TAAGTAGAGGTGAAGCCAGCTGG - Intronic
914419704 1:147518125-147518147 TAAGGAGAGGTGAAGCCAGCTGG - Intergenic
914984966 1:152448596-152448618 TAGGGAGTGCTGAAGGCAGGTGG + Intergenic
915045590 1:153011738-153011760 TATTGACAGGTGAAGCCAGCTGG - Intergenic
916083251 1:161250127-161250149 TAGTGAGAAGTGAAGCCAGCTGG + Intergenic
916406194 1:164500325-164500347 GAGGGCAAGCTGAAGCAAGGTGG + Intergenic
916900653 1:169218982-169219004 TAGGGAAACTTGAAGGCAGATGG + Intronic
916975851 1:170076925-170076947 TAGTGAGAGGTGAACCCAGCTGG + Intronic
917085781 1:171304880-171304902 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
917086873 1:171312400-171312422 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
917279521 1:173367860-173367882 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
917280771 1:173376469-173376491 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
918939964 1:190980655-190980677 TAATGAGAGATGAAGCCAGCTGG - Intergenic
918965619 1:191343867-191343889 TTTTGAAAGGTGAAGCCAGCTGG - Intergenic
919083764 1:192895957-192895979 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
919355988 1:196522574-196522596 TAGTGAGAGGTGAAGCCAGCGGG + Intronic
919558434 1:199091111-199091133 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
920204933 1:204284375-204284397 TAGGGTAAGCTGGAGCCAGGTGG + Intronic
920486788 1:206378549-206378571 TAAGTAGAGGTGAAGCCAGCTGG + Intronic
921136113 1:212260696-212260718 GAGTGAAAGATCAAGCCAGCTGG + Intergenic
921159302 1:212462101-212462123 TTGTGGGAGCTGAAGCCAGCAGG + Intergenic
921743912 1:218715987-218716009 TGGTGAGAGGTGAAGCCAGCTGG - Intergenic
921938675 1:220817696-220817718 CAGTGAGAGGTGAAGCCAGCTGG - Exonic
923903339 1:238354479-238354501 TAGTGAGAGGTGGAGCCAGCTGG + Intergenic
924258165 1:242203124-242203146 TAGGCAAAGATGAAGCAAGCTGG - Intronic
924647648 1:245894051-245894073 TCGTGAGAGGTGAAGCCAGCTGG + Intronic
1063212072 10:3889958-3889980 TGGAGAAATGTGAAGCCAGCAGG - Intergenic
1063414615 10:5863339-5863361 TACTGAGAGGTGAAGCCAGCTGG + Intronic
1063459938 10:6208810-6208832 TATGGAAAGCAGCAGCCAGATGG - Intronic
1063925442 10:10972991-10973013 TAGTTAAAGCAGAAGGCAGCCGG + Intergenic
1064219429 10:13427970-13427992 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1064519863 10:16189782-16189804 TAGGGAAAGCTTACATCAGCAGG - Intergenic
1064694360 10:17950701-17950723 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1066582108 10:36891980-36892002 TAGGGAACACTTAAGCCAGCAGG - Intergenic
1067096842 10:43307208-43307230 TAGTGACAGGTGAAGCCAGCTGG - Intergenic
1067362876 10:45598120-45598142 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1067465882 10:46498442-46498464 CTTTGAAAGCTGAAGCCAGCTGG + Intergenic
1067531670 10:47078754-47078776 TAATGACAGGTGAAGCCAGCTGG - Intergenic
1067532211 10:47082295-47082317 TTGTGAGAGGTGAAGCCAGCTGG + Intergenic
1067542638 10:47166755-47166777 AAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1067621305 10:47886164-47886186 CTTTGAAAGCTGAAGCCAGCTGG - Intergenic
1068078316 10:52286232-52286254 TAGAGAAGGTTGAGGCCAGCTGG - Intronic
1068180978 10:53518338-53518360 TAGTGAAAGCTGGGTCCAGCGGG - Intergenic
1068368505 10:56083674-56083696 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1068462308 10:57343695-57343717 TGGTGAGAGGTGAAGCCAGCTGG + Intergenic
1069137731 10:64785328-64785350 TACTGAGAGGTGAAGCCAGCTGG - Intergenic
1070123947 10:73605176-73605198 CAGTGAGAGGTGAAGCCAGCTGG - Intronic
1070648708 10:78219573-78219595 TGGTGAGAGGTGAAGCCAGCTGG + Intergenic
1071054218 10:81490521-81490543 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1071600142 10:86955038-86955060 TAGGGGATGCTGCTGCCAGCAGG - Intronic
1073337556 10:102721112-102721134 TAGGCAATCCTGAAGTCAGCAGG - Intronic
1074265231 10:111895214-111895236 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1074612651 10:115036898-115036920 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1074742994 10:116502537-116502559 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1075932907 10:126314306-126314328 GAGGGAGAGCAGAAACCAGCTGG + Intronic
1076576556 10:131473710-131473732 TGGGGACAGCTGGAGCCACCAGG - Intergenic
1076896539 10:133315850-133315872 CTGTGAGAGCTGAAGCCAGCTGG + Intronic
1077508234 11:2941903-2941925 TGGGGAAAGCAGCAGCCATCAGG + Intergenic
1077787880 11:5404112-5404134 TTGTGAGAGGTGAAGCCAGCTGG + Intronic
1078051408 11:7967940-7967962 CAGAGAGAGATGAAGCCAGCTGG + Intergenic
1078667737 11:13340314-13340336 GAGGAAAAGCGGAACCCAGCAGG - Intronic
1079925683 11:26489073-26489095 TGGTGAGAGGTGAAGCCAGCTGG - Intronic
1080331955 11:31149241-31149263 TAGTGAGAGGTGAAGCCAGCTGG + Intronic
1080820412 11:35800611-35800633 TACTGAGAGGTGAAGCCAGCTGG - Intronic
1080864399 11:36180515-36180537 TGGGGACAGCTGAAGACAGGAGG + Intronic
1081033053 11:38111064-38111086 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1081033802 11:38116660-38116682 GATTGAAAGGTGAAGCCAGCTGG + Intergenic
1081121379 11:39270884-39270906 TGGTGAGAGGTGAAGCCAGCTGG + Intergenic
1081145633 11:39560211-39560233 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
1081541388 11:44037035-44037057 TGGGGAGAGCTGAGGGCAGCTGG + Intergenic
1081867339 11:46366986-46367008 TAGGTATAGCTGTGGCCAGCAGG + Intronic
1081965194 11:47165112-47165134 TAGGGAAAGCGGAAGGTAGAAGG - Exonic
1082011610 11:47453423-47453445 TGGTGAGAGGTGAAGCCAGCTGG + Intergenic
1083236379 11:61353489-61353511 TGGGGAAAGTGGAAGCCAGATGG + Intronic
1084016906 11:66389082-66389104 TATGGAAAGCTGTGGCCTGCAGG + Intergenic
1084702243 11:70795031-70795053 AAGGGCAAGCAGAACCCAGCAGG + Intronic
1085038377 11:73312870-73312892 CAGGGATAGCTGAAGCCAGAAGG - Intronic
1085420689 11:76356290-76356312 CAGTGACAGCTGAAGACAGCAGG + Intronic
1086597166 11:88586603-88586625 TTGGAATAGCTGAAGCCATCAGG + Intronic
1087074669 11:94118241-94118263 TAATGAGAGGTGAAGCCAGCTGG + Intergenic
1087445033 11:98240423-98240445 AAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1087445379 11:98244335-98244357 TAGTGAGAAGTGAAGCCAGCTGG - Intergenic
1088177503 11:107070531-107070553 AAGGGAAAGGGGAAGCCAACTGG + Intergenic
1088892730 11:114058120-114058142 CAGGGAAAGCTCAGCCCAGCAGG - Intergenic
1088959835 11:114651874-114651896 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1089498156 11:118918154-118918176 TAGGGAAAGCTGGAGGAAGCTGG - Intronic
1089978274 11:122751512-122751534 TAGGGTAGGCTGGAGCCAGGAGG - Intronic
1090702697 11:129310706-129310728 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1091127034 11:133109646-133109668 TGGTGAAAGGTGAAGCCAGCTGG - Intronic
1091374261 12:15786-15808 TAGGGGAAGCAGGGGCCAGCTGG + Intergenic
1091585597 12:1814521-1814543 AAGTGAGAGCTGAAGCCAGCTGG - Intronic
1092109025 12:5945753-5945775 TAGGGGAAGGTGAGGACAGCTGG - Intronic
1093213293 12:16333002-16333024 TGGTGAGAGGTGAAGCCAGCTGG - Intergenic
1093501943 12:19823377-19823399 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1093967413 12:25341834-25341856 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1094320946 12:29182604-29182626 TAGTGAGAGGTGAAGCCAGCTGG - Intronic
1094597965 12:31882703-31882725 TGGTGAGAGCTGAAGCCAGCTGG + Intergenic
1095898832 12:47306616-47306638 CAGTGAAAGGTGAAGCCTGCTGG + Intergenic
1096545656 12:52338327-52338349 TAGGAAATGTTGAAGTCAGCCGG + Intergenic
1096750480 12:53755839-53755861 TTGGGCAAGATGAAGACAGCTGG - Intergenic
1096854062 12:54466327-54466349 TAGGAAAATCAGAAGCCAGTGGG + Intronic
1097414274 12:59295353-59295375 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
1099299880 12:80878963-80878985 TTGTGAGAGGTGAAGCCAGCTGG - Intronic
1100073168 12:90746538-90746560 TAGTGAGCGGTGAAGCCAGCTGG + Intergenic
1100528787 12:95445469-95445491 TACTGAGAGGTGAAGCCAGCTGG - Intergenic
1100610003 12:96184012-96184034 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1101346459 12:103890629-103890651 TTGGTTAAGCTGAGGCCAGCTGG - Intergenic
1101987430 12:109458550-109458572 GGGGGAAAGCTGAAACCAGTGGG + Intronic
1102798153 12:115707367-115707389 TAGGGAAAACTGAGGCTAGAAGG - Intergenic
1105225694 13:18429524-18429546 TAGGGGAAGCTGTAGGCAGTAGG - Intergenic
1105401191 13:20097454-20097476 TAGTAAGAGGTGAAGCCAGCTGG - Intergenic
1105520951 13:21130455-21130477 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1105676865 13:22681028-22681050 TACTGAGAGGTGAAGCCAGCCGG + Intergenic
1105690270 13:22830842-22830864 TGGTGAGAGGTGAAGCCAGCTGG - Intergenic
1105716740 13:23073622-23073644 TAATGAGAGGTGAAGCCAGCTGG - Intergenic
1106356726 13:28990353-28990375 GAGTGAGAGGTGAAGCCAGCTGG + Intronic
1106679421 13:31994801-31994823 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1106755837 13:32821905-32821927 TAGGGACAGGTGAAGCTGGCGGG - Intergenic
1107012869 13:35685252-35685274 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1107398209 13:40040934-40040956 TGGTGAGAGGTGAAGCCAGCTGG + Intergenic
1107634794 13:42381242-42381264 TCGTGAGAGGTGAAGCCAGCAGG + Intergenic
1107840897 13:44456567-44456589 TTGTGAAAGGTGAAGCCGGCTGG - Intronic
1108735441 13:53278897-53278919 TGGTGAGAGGTGAAGCCAGCTGG + Intergenic
1108817814 13:54313268-54313290 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1109138824 13:58687805-58687827 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1109163836 13:59009157-59009179 TAGTGAGAGGTGAAGCCAACTGG + Intergenic
1109434013 13:62274726-62274748 TAATGAGAGGTGAAGCCAGCTGG - Intergenic
1109508560 13:63337794-63337816 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1109735519 13:66479525-66479547 TACTGAGAGGTGAAGCCAGCTGG + Intronic
1110079274 13:71290357-71290379 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1110866048 13:80397715-80397737 TAGGCATAGCTGAAGCCTGTTGG + Intergenic
1110947161 13:81436840-81436862 TAGGGAAAACTGAAGCCAACAGG - Intergenic
1111043837 13:82788947-82788969 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
1111197523 13:84894592-84894614 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1111250491 13:85595043-85595065 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
1111466954 13:88625910-88625932 TCGGGAAAGCTGAACCCGGGAGG + Intergenic
1111532058 13:89550567-89550589 TGGTGAGAGGTGAAGCCAGCTGG + Intergenic
1111710249 13:91802710-91802732 TAGTGAAAGGTGAAGCTGGCTGG - Intronic
1111729288 13:92052731-92052753 TACTGAGAGGTGAAGCCAGCTGG - Intronic
1112028039 13:95430394-95430416 TAGTGAAAGCTGGATCCAGGGGG + Intergenic
1112086762 13:96040311-96040333 AAGGAACAGCTGAAGCCACCAGG - Intronic
1112859614 13:103814324-103814346 TGGTGAAAGGTGAAGTCAGCTGG + Intergenic
1113227802 13:108178058-108178080 TAATGAGAGGTGAAGCCAGCTGG + Intergenic
1113249689 13:108438232-108438254 TAGGAAGAGCTGAAGGAAGCAGG - Intergenic
1113338481 13:109399607-109399629 TACTGAGAGGTGAAGCCAGCTGG - Intergenic
1113551894 13:111199093-111199115 TATTGAGAGGTGAAGCCAGCTGG - Intronic
1113702128 13:112395891-112395913 TAGGTAGAGATGAAGCCAGCAGG - Intronic
1114010146 14:18357875-18357897 TAGGGGAAGCTGTAGACAGTAGG - Intergenic
1114772197 14:25440649-25440671 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1115736865 14:36341810-36341832 AAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1116156143 14:41208731-41208753 TATTGATAGGTGAAGCCAGCTGG - Intergenic
1116329800 14:43581139-43581161 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1116346903 14:43805036-43805058 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1117000236 14:51364547-51364569 CAGGGAAAATTGAAGCCATCAGG - Intergenic
1117305768 14:54471741-54471763 GAGGGAAAGAAGATGCCAGCTGG - Intergenic
1117707427 14:58485763-58485785 TAGGGAAAGATGAAGACAGCAGG - Intronic
1117723068 14:58646195-58646217 CGGGGAAAGCTGTAGACAGCAGG - Exonic
1118816075 14:69314896-69314918 TAGTGAAAGGTAAACCCAGCAGG + Intronic
1120204922 14:81577608-81577630 AACTGAAAGCTGAAGCCATCTGG + Intergenic
1120219014 14:81711933-81711955 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1121287818 14:92750086-92750108 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1122218873 14:100222633-100222655 TTGGGAAGGCTGAAGTCAGGTGG - Intergenic
1123814450 15:23962439-23962461 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1124194477 15:27609179-27609201 TAGTGAGAGGTGAAGGCAGCTGG - Intergenic
1124223491 15:27869865-27869887 CAGGGAGAGGTGGAGCCAGCTGG + Intronic
1124247333 15:28082042-28082064 TAGTGAGAAGTGAAGCCAGCTGG + Intronic
1124385850 15:29207726-29207748 AAGAGAGAGGTGAAGCCAGCTGG - Intronic
1124598817 15:31114111-31114133 TAGTGAGAGGTGAAGCCAGCTGG - Intronic
1124613734 15:31226454-31226476 CACTGAAAGGTGAAGCCAGCGGG - Intergenic
1124655998 15:31507883-31507905 TACTGAGAGGTGAAGCCAGCTGG - Intronic
1124828973 15:33129125-33129147 TATTGAGAGGTGAAGCCAGCTGG - Intronic
1124860571 15:33436102-33436124 TATTGAGAGGTGAAGCCAGCTGG - Intronic
1124869125 15:33523022-33523044 TATTGAGAGGTGAAGCCAGCTGG + Intronic
1125264548 15:37864070-37864092 TATTGAGAGTTGAAGCCAGCTGG + Intergenic
1125529025 15:40399402-40399424 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1126188198 15:45851230-45851252 TAATGAGAGGTGAAGCCAGCTGG - Intergenic
1126317437 15:47385489-47385511 CAGGGAAAGCAGAGGCCAGGTGG - Intronic
1126734836 15:51720622-51720644 TAGTGAGAGGTGAAGCCAGCTGG + Exonic
1127093226 15:55487089-55487111 TAGTGAGAGGTGAAGCCAGCTGG + Intronic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1128558950 15:68651861-68651883 TATGGAAATCTCAAGCAAGCTGG - Intronic
1128629722 15:69252369-69252391 AAGGCAAAGCTGGAGCAAGCAGG + Intronic
1129185292 15:73902416-73902438 TAAGGAAGGCTTAAGCAAGCTGG + Intergenic
1129984884 15:79909856-79909878 TATTGAGAGGTGAAGCCAGCTGG - Intronic
1130028562 15:80291527-80291549 TGGTGAGAGGTGAAGCCAGCTGG - Intergenic
1130065006 15:80595840-80595862 TGGGGCAAGCTCAAGCCTGCTGG - Exonic
1130656716 15:85796393-85796415 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1130923219 15:88366239-88366261 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1131198338 15:90375127-90375149 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1131367051 15:91850519-91850541 GAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1131410839 15:92207151-92207173 AAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1131692041 15:94837668-94837690 TGGTGAGAGGTGAAGCCAGCTGG - Intergenic
1131760445 15:95617074-95617096 TAGTGAAAGATCAACCCAGCTGG + Intergenic
1131782270 15:95872348-95872370 TAATGAGAGGTGAAGCCAGCTGG - Intergenic
1131908781 15:97173030-97173052 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
1131913378 15:97234021-97234043 TCGTGAGAGGTGAAGCCAGCTGG + Intergenic
1132452337 15:101975270-101975292 TAGGGGAAGCAGGGGCCAGCTGG - Intergenic
1132454558 16:15353-15375 TAGGGGAAGCAGGGGCCAGCTGG + Intronic
1134009230 16:10838946-10838968 TAGGGAAAACTGAGGCCTGTGGG + Intergenic
1135297061 16:21289694-21289716 AAGTGAGAGTTGAAGCCAGCTGG + Intronic
1135400277 16:22162325-22162347 GAGGGGAAACTGAAGCCAGTAGG - Intergenic
1136242466 16:28952495-28952517 TTGGGAACACTGGAGCCAGCAGG + Intronic
1138169630 16:54836618-54836640 TAGGGAAAGCTGTGGCAAGCCGG + Intergenic
1138526972 16:57614483-57614505 TAGGGAAATCAGGAGCCAGGAGG + Intronic
1139270010 16:65673091-65673113 CAGGGAAAGCTGTCACCAGCAGG + Intergenic
1139666349 16:68459582-68459604 TAGGGATAGCAGAGGCCAGAGGG + Intergenic
1139676008 16:68524091-68524113 GAGCGAGAGGTGAAGCCAGCTGG - Intergenic
1139971832 16:70781201-70781223 GAGGCAAAGAGGAAGCCAGCAGG - Intronic
1141342236 16:83213741-83213763 TAATGAGAGGTGAAGCCAGCTGG + Intronic
1141541480 16:84726284-84726306 GCGGGAGAGCTGTAGCCAGCAGG + Intronic
1141547449 16:84780592-84780614 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1141859552 16:86707031-86707053 TTGGGGAAACTGAGGCCAGCAGG - Intergenic
1142135295 16:88449247-88449269 GATGGAAGGGTGAAGCCAGCGGG - Intergenic
1142228162 16:88887448-88887470 TGGGGCCAGCTGAGGCCAGCTGG + Intronic
1143705385 17:8694324-8694346 TAGGGAAAGCTGCCACCAGTGGG - Intergenic
1143768308 17:9151739-9151761 TGTGGAGAGGTGAAGCCAGCTGG + Intronic
1144144492 17:12384119-12384141 GAGTGACAGGTGAAGCCAGCTGG + Intergenic
1144440582 17:15277521-15277543 TGGGGAGAGCAGAAGGCAGCTGG + Intergenic
1145062499 17:19741967-19741989 TAAGGACTGCTGCAGCCAGCAGG + Intronic
1145730603 17:27181320-27181342 TAGAGAAAGCTGGATCCAGGGGG + Intergenic
1145822184 17:27847281-27847303 TAATGAGAGGTGAAGCCAGCTGG - Intronic
1146053726 17:29570891-29570913 CAGGGGGAGCTGATGCCAGCTGG - Intronic
1146306223 17:31731594-31731616 TGGTGAGAGGTGAAGCCAGCTGG + Intergenic
1146319164 17:31833101-31833123 TGGAGAGAGGTGAAGCCAGCTGG - Intergenic
1146591644 17:34132706-34132728 TAGTGAGAGGTGAAGCCAGCTGG - Intronic
1147958469 17:44151298-44151320 CAGGGGAAGCTGGAGCTAGCTGG - Intronic
1148073160 17:44920492-44920514 CAGTGAAAGCTGAACACAGCAGG + Intergenic
1148204767 17:45773250-45773272 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1148460119 17:47834952-47834974 TGGGGAAAGTTGAAGCGAGCTGG - Intronic
1148990906 17:51666432-51666454 TAGGGAATGTTGATGACAGCAGG + Intronic
1149537140 17:57441840-57441862 TAGGCAAAGATGATGCCTGCAGG + Intronic
1149972929 17:61237095-61237117 TACTGAGAGGTGAAGCCAGCTGG + Intronic
1150135986 17:62695370-62695392 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1150646627 17:66982604-66982626 TATTGAGAGGTGAAGCCAGCTGG - Intronic
1151463093 17:74267017-74267039 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1152878168 17:82800227-82800249 GAGGGCAAGCTGAGGCCAGGAGG - Intronic
1152889257 17:82871054-82871076 ATGAGAAAACTGAAGCCAGCAGG + Intronic
1152920604 17:83064691-83064713 TTGGAAATGCTGATGCCAGCAGG + Intergenic
1153071963 18:1116383-1116405 AAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1153225746 18:2898360-2898382 CAGGGGAAGCTAAAGCCAGCTGG - Intronic
1153906704 18:9668171-9668193 TGGTGAGAGGTGAAGCCAGCTGG + Intergenic
1153934852 18:9912653-9912675 GAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1154080153 18:11248286-11248308 TTGTGAGAGGTGAAGCCAGCTGG + Intergenic
1154527684 18:15309997-15310019 TAGGGGAAGCTGTAGGCAGTAGG + Intergenic
1155477097 18:26245781-26245803 TAATGAGAGGTGAAGCCAGCTGG - Intronic
1155574003 18:27225368-27225390 TGGTGAGAGGTGAAGCCAGCTGG - Intergenic
1155602936 18:27569899-27569921 AAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1155678273 18:28457524-28457546 TACCCTAAGCTGAAGCCAGCCGG + Intergenic
1155824245 18:30419376-30419398 TTGTGAGAGGTGAAGCCAGCTGG + Intergenic
1156363761 18:36407074-36407096 CAGGGAAAGCAGAGGACAGCAGG - Intronic
1156410081 18:36819590-36819612 GAGGGAGAGCAGAAGCCACCTGG + Intronic
1156764516 18:40635399-40635421 TAGTGAGAGGTGAAGCCAGTTGG - Intergenic
1159161592 18:64648785-64648807 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1159163237 18:64671268-64671290 TAATGAGAGGTGAAGCCAGCTGG + Intergenic
1159312051 18:66721781-66721803 TACTGAGAGGTGAAGCCAGCTGG - Intergenic
1160507929 18:79437603-79437625 GGGGGAAAGCTGAGGCCAGAGGG - Intronic
1162109321 19:8391499-8391521 TAGGGACAGCTGGAGGAAGCCGG + Intronic
1162502984 19:11065106-11065128 TAGGGATACCTGGGGCCAGCTGG + Intronic
1162866957 19:13555194-13555216 GGGGGAGAGCTGGAGCCAGCTGG - Intronic
1163983338 19:20922436-20922458 TAGAAAAAGCTGATGGCAGCAGG - Intergenic
1164004659 19:21137375-21137397 TAGAAAGAGCTGAGGCCAGCAGG + Intergenic
1164993341 19:32700503-32700525 CAGTGAGAGGTGAAGCCAGCTGG - Intronic
1164999250 19:32747583-32747605 TAGGAAAAGCTGTAGGCAGTGGG - Intronic
1165200868 19:34143445-34143467 CAGGAAAATCTGAAGCCAGGAGG + Intergenic
1165884556 19:39068662-39068684 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1166009242 19:39929013-39929035 TAGAAAAACCTGAAGACAGCTGG + Intronic
1166344195 19:42155182-42155204 CAGAGAAAGATGAAGGCAGCCGG - Intronic
1166376900 19:42332660-42332682 TAGGAAAAGCCAAAGCCGGCTGG - Intronic
1167790552 19:51676234-51676256 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1168092403 19:54094910-54094932 TAGTGAGACGTGAAGCCAGCTGG - Exonic
925059902 2:883014-883036 CAGGGAAGGCTGAAGGCAGAAGG + Intergenic
925065037 2:922912-922934 GTGGGAACGCTGAAGACAGCCGG + Intergenic
925421849 2:3719024-3719046 TAGTGAGAGGTGAAGCCAGCTGG - Intronic
925438183 2:3859560-3859582 TAGTGACAGGTGAAGCCAGCTGG - Intergenic
925899695 2:8500031-8500053 TGGGGAAACCAGAAGCCAGCTGG - Intergenic
926238686 2:11068867-11068889 CAGGGAAAGCTGAGGGGAGCGGG + Intergenic
927900093 2:26812826-26812848 TAGTGAAGGCTGAGGCCAGGAGG - Intergenic
927934554 2:27068990-27069012 CAGGGAAAGCCAAAGCTAGCAGG - Intronic
928316463 2:30250410-30250432 TAGGGAAAGCGGACACCAGCAGG - Intronic
928339471 2:30429372-30429394 TAGTAAAAGCTGGAGCTAGCTGG + Intergenic
928595976 2:32859158-32859180 TAATGAGAGGTGAAGCCAGCTGG - Intergenic
928690895 2:33797496-33797518 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
928700150 2:33890749-33890771 AAGTGAGAGGTGAAGCCAGCTGG + Intergenic
929330012 2:40671990-40672012 TAGTGAGAGGTGTAGCCAGCTGG + Intergenic
931100196 2:58990598-58990620 AAGTGAAAGCTGATGTCAGCTGG - Intergenic
931540081 2:63322003-63322025 TACTGAGAGGTGAAGCCAGCTGG + Intronic
932782423 2:74568937-74568959 TAGAGAAAGCTAACACCAGCTGG + Intronic
933055485 2:77657934-77657956 TTGTGAGAGGTGAAGCCAGCTGG - Intergenic
933340779 2:81023656-81023678 TATGGAAACCAAAAGCCAGCAGG - Intergenic
933341804 2:81035123-81035145 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
933505997 2:83177802-83177824 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
933537889 2:83599927-83599949 TAGTGAGAGGTGAAGCCAGCAGG - Intergenic
933623343 2:84570237-84570259 TGGTGAGAGGTGAAGCCAGCTGG + Intronic
933687541 2:85155143-85155165 TGGTGAGAGGTGAAGCCAGCTGG + Intronic
933730913 2:85455781-85455803 TGGTGAGAGGTGAAGCCAGCTGG - Intergenic
934217399 2:90045843-90045865 TAGTGAGAGGTGAGGCCAGCTGG - Intergenic
934649940 2:96085005-96085027 CAGGGGAAGCTCAAGCCACCAGG + Intergenic
934786664 2:97014364-97014386 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
935482980 2:103616505-103616527 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
935680642 2:105633835-105633857 TTGGGGAAACTGATGCCAGCTGG + Intergenic
935762430 2:106333844-106333866 TAGTGAGAAGTGAAGCCAGCTGG - Intergenic
935897582 2:107754173-107754195 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
936090138 2:109496459-109496481 TAGTGAAAGGTGAAGCCAGCTGG - Intronic
936249425 2:110856233-110856255 TATTGAGAGGTGAAGCCAGCTGG - Intronic
936488312 2:112946495-112946517 AAGAGAAAATTGAAGCCAGCAGG + Intergenic
936568552 2:113597743-113597765 TAGGGGAAGCAGGGGCCAGCTGG - Intergenic
936922673 2:117705245-117705267 TAATGAGAGGTGAAGCCAGCTGG - Intergenic
937118039 2:119423057-119423079 TGGGGAAGGCTGATGCCAGAGGG + Intergenic
937210901 2:120269701-120269723 TAGTGAGAGGTGAAGCCAGCTGG - Intronic
937706585 2:124927744-124927766 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
937995946 2:127695192-127695214 TTTGGGAGGCTGAAGCCAGCAGG - Intergenic
938038222 2:128054092-128054114 AAGTGAGAGGTGAAGCCAGCTGG - Intergenic
938056111 2:128215920-128215942 TAGTAAAAGGTGAAGCCAGCTGG + Intergenic
938129350 2:128697926-128697948 TACTGAGAGGTGAAGCCAGCTGG - Intergenic
938512641 2:131966708-131966730 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
938526778 2:132141454-132141476 TAGGGGAAGCTGTAGGCAGTAGG + Intergenic
938707642 2:133946281-133946303 TAAAGAAAGGTGATGCCAGCAGG + Intergenic
938805585 2:134804484-134804506 TACTGAGAGGTGAAGCCAGCTGG - Intergenic
938806565 2:134811630-134811652 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
939255841 2:139743923-139743945 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
939410227 2:141815328-141815350 TAGTGAGAGGTGAAGCCAGCTGG + Intronic
939551979 2:143626826-143626848 TAATGACAGGTGAAGCCAGCTGG - Intronic
939912045 2:147994917-147994939 TGGTGACAGGTGAAGCCAGCTGG + Intronic
941313560 2:163964589-163964611 TAGAGAGCGGTGAAGCCAGCTGG - Intergenic
941379688 2:164777769-164777791 TAGGGGTACCTGCAGCCAGCTGG + Intronic
942172512 2:173301865-173301887 TAATGAGAGGTGAAGCCAGCTGG - Intergenic
942425596 2:175857350-175857372 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
942740010 2:179165626-179165648 AAGTAAAAGCTGAAGCCAGGAGG - Intronic
943190390 2:184670888-184670910 TAGGCAAAGAGGAAGACAGCTGG - Intronic
943645884 2:190408043-190408065 GAGGGACACCTGAACCCAGCCGG - Intergenic
943897459 2:193383450-193383472 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
944248791 2:197560449-197560471 TAGTGAAAGCTAAAGGCAGATGG - Intergenic
944447975 2:199810907-199810929 TAGGGAAAAGTGAACCCAGAAGG - Intronic
944857275 2:203780030-203780052 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
945112810 2:206378980-206379002 TAGGGGCAGCTGAAGGGAGCTGG + Intergenic
945600807 2:211862810-211862832 TAGTGAGAGGTGAAGCCAGTTGG + Intronic
948237670 2:236402593-236402615 CAGGGGGAGCTGCAGCCAGCGGG + Intronic
948262214 2:236612852-236612874 GAGGGCAAGCCCAAGCCAGCTGG - Intergenic
1169433106 20:5557159-5557181 AAGGAAAAGCTGAAGCCTGAGGG - Intronic
1171320842 20:24242675-24242697 GAGGTAAAACCGAAGCCAGCAGG - Intergenic
1172341010 20:34157531-34157553 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1172447807 20:35002281-35002303 CAGGGAAGGCTGAAGGCAGCAGG - Exonic
1172486067 20:35298466-35298488 AAGGGAGAGCTCATGCCAGCTGG - Intergenic
1172491904 20:35345986-35346008 TAGTGGGAGGTGAAGCCAGCTGG + Intronic
1172875334 20:38160688-38160710 CATGGAAGGCTGAAGCTAGCTGG + Intronic
1173292642 20:41728079-41728101 TAGTGAGAGGTCAAGCCAGCTGG - Intergenic
1173674776 20:44824186-44824208 AAGGGCAAGCTGAAGGCAGATGG - Intergenic
1173978148 20:47202822-47202844 AAGGGCAAGCTGGAGCCTGCTGG + Intergenic
1174397263 20:50254783-50254805 TAGGGAAAGATTAAGGCAGTCGG - Intergenic
1174400347 20:50272460-50272482 TGGGGTCAGCTGAACCCAGCTGG + Intergenic
1175658245 20:60790601-60790623 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1175734913 20:61378471-61378493 CAAGGAAAGCCGGAGCCAGCAGG - Intronic
1176769747 21:13058547-13058569 TAGGGGAAGCTGTAGGCAGTAGG - Intergenic
1177691158 21:24509553-24509575 TAATGAGAGATGAAGCCAGCTGG + Intergenic
1178261991 21:31108064-31108086 AAGGCAAAGGGGAAGCCAGCTGG - Intergenic
1178300051 21:31445290-31445312 TACAGAAGGTTGAAGCCAGCAGG - Intronic
1178517152 21:33257721-33257743 AAGTGAAAGGTGAGGCCAGCTGG - Intronic
1179427400 21:41292584-41292606 TACTGAGAGATGAAGCCAGCTGG + Intergenic
1180434644 22:15288684-15288706 TAGGGGAAGCTGTAGACAGTAGG - Intergenic
1180516854 22:16152490-16152512 TAGGGGAAGCTGTAGGCAGTAGG - Intergenic
1180647057 22:17347924-17347946 CAGAGAAAGTTGAAGCAAGCAGG - Intergenic
1180656748 22:17427847-17427869 TACTGAGAGATGAAGCCAGCTGG - Intronic
1182642943 22:31782994-31783016 TGGTGAGAGGTGAAGCCAGCTGG + Intronic
1182655858 22:31889242-31889264 TACTGAAAGCTGAACTCAGCTGG + Intronic
1183165117 22:36141647-36141669 CAGCAGAAGCTGAAGCCAGCAGG - Exonic
1183329093 22:37209816-37209838 CTGGGAAAGCGGATGCCAGCTGG - Intronic
1183350739 22:37333308-37333330 CAGGGGAATCTGCAGCCAGCCGG - Intergenic
1183493262 22:38127891-38127913 GAGGGACAGGTGAAGCCAGAGGG + Intronic
1184362664 22:44027496-44027518 CAGAGACAGCTGAAGGCAGCGGG + Intronic
1184642781 22:45881045-45881067 GAGAGAATGCTGGAGCCAGCCGG + Intergenic
1185165848 22:49261710-49261732 AAGGGGAAGCTGAAGCCCGTGGG - Intergenic
1185349556 22:50327326-50327348 CAGAGCAAGCTGCAGCCAGCCGG + Intergenic
949648530 3:6127511-6127533 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
949671873 3:6406958-6406980 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
949723216 3:7014802-7014824 TAGTGAGAGGTGAAGCCAGCTGG + Intronic
950204032 3:11064244-11064266 TATTGAGAGCTGAAGCCAGCTGG - Intergenic
950238829 3:11349267-11349289 TAGTGAGAGGTGAAACCAGCTGG - Intronic
952302449 3:32115435-32115457 TAATGAGAGGTGAAGCCAGCTGG - Intronic
953754069 3:45631612-45631634 GAGGGACAGCTGAAGGCAGAGGG + Intronic
953759125 3:45673108-45673130 TAGGTAACGCTGAAGCCACAGGG - Intronic
954255657 3:49404001-49404023 TAGTGAAAGTTGAAGATAGCTGG + Intronic
954992909 3:54856303-54856325 TAGGGAAGGCTGCAGGGAGCTGG + Intronic
955063473 3:55514551-55514573 TAGGGAAATCTGAAACCAGAGGG + Intronic
956190261 3:66601323-66601345 TAGGAAAAGCTGAAGAGGGCAGG - Intergenic
957510395 3:81180685-81180707 TAGTGAAAGGTGAAGCCGACTGG + Intergenic
958601007 3:96297543-96297565 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
959095727 3:101953166-101953188 TAGGGCAAGCTGAAGCCCGTTGG - Intergenic
959247965 3:103899670-103899692 TAGTGACAGGTGAAGCCAGCTGG - Intergenic
959306837 3:104678034-104678056 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
960327649 3:116316960-116316982 TACTGAGAGGTGAAGCCAGCTGG + Intronic
960352078 3:116606274-116606296 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
960434543 3:117609607-117609629 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
960445459 3:117743518-117743540 AAGTGAGAGGTGAAGCCAGCTGG - Intergenic
961261298 3:125604322-125604344 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
961794369 3:129399018-129399040 TAGGGCCAGATGAAGCCTGCAGG + Intergenic
962106640 3:132396614-132396636 CAGTGAAAGGTGAAGCCGGCTGG + Intergenic
962201665 3:133405151-133405173 AAGGAACAGCTGAAGCCAGGGGG + Intronic
962374349 3:134847717-134847739 TATGGAACACTGAAGCCAGGTGG - Intronic
963431160 3:145205452-145205474 AAGTGAGAGGTGAAGCCAGCTGG - Intergenic
963926997 3:150961186-150961208 TAGGGAAGGCAGAAGCCACAAGG - Intronic
963992676 3:151671262-151671284 TACTGAGAGGTGAAGCCAGCTGG - Intergenic
964083733 3:152790623-152790645 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
964184323 3:153924435-153924457 TGGTGAGAGGTGAAGCCAGCTGG - Intergenic
964852827 3:161113320-161113342 TTTGGAAGGCTGAAGCCAGAGGG + Intronic
966638000 3:182157002-182157024 GAGGGCAAGCTGAAGCAAGGTGG - Intergenic
967293288 3:187942647-187942669 TTGGGAAAGCTGAAGTCAAGAGG - Intergenic
967727657 3:192876823-192876845 TAGAGAAAGCTGGAGCCCGAAGG - Intronic
967734610 3:192939169-192939191 TAGCGAGAGGTGCAGCCAGCTGG - Intergenic
967857645 3:194130391-194130413 TAGGGTGGGCAGAAGCCAGCTGG - Intergenic
967950993 3:194840443-194840465 TAGTGAGAGGTGAAGCCGGCTGG + Intergenic
968034769 3:195538135-195538157 GGGGGAAAACTGAAACCAGCAGG - Intronic
968212840 3:196863428-196863450 TAGTGACAGGTGAAGCCAGCTGG - Intergenic
969047706 4:4349127-4349149 CAGTGAGAGGTGAAGCCAGCTGG - Intronic
969854899 4:9991186-9991208 TGGGGAAAGCAGAAAGCAGCAGG - Intronic
970193574 4:13536085-13536107 GAGGGAAAGCTGAGGAGAGCGGG + Intergenic
970394088 4:15647963-15647985 TTCGGAAGGCTGAGGCCAGCAGG - Intronic
970699983 4:18724907-18724929 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
970720523 4:18983107-18983129 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
970783712 4:19770718-19770740 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
971322098 4:25613949-25613971 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
971330557 4:25677913-25677935 TGGGGAAAGCTGTACCCAACTGG + Exonic
971394597 4:26216506-26216528 TGGGGCAAGGTGAAGCCAGAGGG + Intronic
971419567 4:26463144-26463166 CAGGGAAAGTTGAAGCCTGTTGG - Intergenic
971793846 4:31201693-31201715 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
971891041 4:32522115-32522137 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
972550178 4:40125484-40125506 TAGAGGAAGTTGTAGCCAGCTGG - Intronic
972791344 4:42374102-42374124 TACTGAGAGATGAAGCCAGCTGG - Intergenic
972889296 4:43536535-43536557 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
973046707 4:45542430-45542452 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
973613341 4:52657834-52657856 TGCTGAAAGCTGAAGCCAGCGGG + Intronic
973889274 4:55353169-55353191 TAGTGAGAAGTGAAGCCAGCTGG + Intronic
974075793 4:57167134-57167156 TAGCCAAAGCTGAGGCCAGGGGG - Intergenic
974159944 4:58125334-58125356 TACTGAGAGGTGAAGCCAGCTGG - Intergenic
974509790 4:62823695-62823717 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
975047602 4:69824560-69824582 TAGTGAGAGGTGAAGCCAGCCGG + Intronic
975182024 4:71357200-71357222 AAGAGAAAGCAGCAGCCAGCTGG - Intronic
975349022 4:73325852-73325874 TAGTGAGAGGTGAATCCAGCTGG + Intergenic
975658488 4:76665236-76665258 TAGGTAAAGCTGCAGCCAAGTGG - Intronic
975707126 4:77122305-77122327 TAGAGAAGGAAGAAGCCAGCAGG + Intergenic
976174721 4:82339283-82339305 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
976727467 4:88228638-88228660 TTCTGAAAGGTGAAGCCAGCTGG + Intronic
976862359 4:89680627-89680649 AAGTGAGAGGTGAAGCCAGCTGG - Intergenic
977024450 4:91798503-91798525 TTGTGAGAGGTGAAGCCAGCTGG + Intergenic
977081627 4:92536405-92536427 TAGTGAGAGGTGAAGCCGGCTGG - Intronic
977640605 4:99354258-99354280 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
977821593 4:101478302-101478324 TGGTGAGAGGTGAAGCCAGCTGG + Intronic
978544772 4:109859166-109859188 TAGTGAAAGCTGGATCCAGGGGG + Intronic
979235237 4:118392573-118392595 CAGTGATAGGTGAAGCCAGCTGG + Intergenic
979281934 4:118878459-118878481 AAGGGAGAGGTGAAGCCAGCTGG + Intronic
980001736 4:127497511-127497533 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
980373713 4:131913830-131913852 TACTGAGAGGTGAAGCCAGCTGG - Intergenic
980760197 4:137222826-137222848 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
981315802 4:143337996-143338018 AGGGGACAGCTGAAGCCAGAAGG + Intronic
981726188 4:147849927-147849949 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
982036784 4:151353753-151353775 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
982179918 4:152740828-152740850 GAGGGAAAGCTGAACCTGGCTGG + Intronic
982486205 4:155968592-155968614 GAATGAAAGGTGAAGCCAGCTGG - Intergenic
982876917 4:160662149-160662171 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
983033755 4:162836692-162836714 AAGTGAGAGGTGAAGCCAGCTGG - Intergenic
983820742 4:172191013-172191035 GAGGGAGAGATGAAGCCACCAGG - Intronic
983957797 4:173717631-173717653 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
984180491 4:176476864-176476886 AAGTGAGAGATGAAGCCAGCTGG - Intergenic
984228709 4:177066764-177066786 TGGTGAGAGGTGAAGCCAGCTGG - Intergenic
984404605 4:179311797-179311819 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
984409582 4:179379194-179379216 TAATGAGAGGTGAAGCCAGCTGG - Intergenic
985151049 4:186947135-186947157 AAGGGAGAGGTGAAGGCAGCTGG - Intergenic
985907808 5:2854731-2854753 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
986362848 5:6998381-6998403 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
986929149 5:12796171-12796193 TAGTCAGAGGTGAAGCCAGCTGG + Intergenic
987304317 5:16623447-16623469 CAGAGAAAGCTGAAGAAAGCAGG - Intergenic
987343312 5:16957295-16957317 TGGTGAGAGGTGAAGCCAGCTGG + Intergenic
987363879 5:17130997-17131019 TAGTGAGAGGTGAAGCCAGTTGG - Intronic
987467160 5:18285680-18285702 TAGTGAGAGGTGAGGCCAGCTGG + Intergenic
987676644 5:21083205-21083227 TGGTGAGAGGTGAAGCCAGCTGG + Intergenic
988039965 5:25876352-25876374 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
988605172 5:32673179-32673201 TAGTGAGAGGTGAGGCCAGCTGG - Intergenic
988774069 5:34461045-34461067 TAGTGAAAGCTGAGTCCAGGGGG + Intergenic
989069486 5:37496010-37496032 TAATGAGAGGTGAAGCCAGCTGG + Intronic
989281834 5:39653308-39653330 TACTGAGAGGTGAAGCCAGCTGG - Intergenic
989553016 5:42757430-42757452 TGGGGATGGTTGAAGCCAGCAGG + Intronic
989756245 5:44959017-44959039 TAATGAGAGGTGAAGCCAGCTGG + Intergenic
989757681 5:44975312-44975334 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
989759803 5:44999967-44999989 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
989760238 5:45007150-45007172 TAGGGAGAAGTGAAGCCAGCTGG + Intergenic
989760504 5:45010207-45010229 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
989761014 5:45016466-45016488 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
989780070 5:45254182-45254204 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
990116376 5:52397269-52397291 TAGTAAGAGGTGAAGCCAGCTGG + Intergenic
990176319 5:53112335-53112357 TTGTGAGAGGTGAAGCCAGCTGG + Intergenic
990816972 5:59796485-59796507 TGGAGAAAGCTGAAGACAGTGGG - Intronic
991453793 5:66780941-66780963 TATTGAGAGGTGAAGCCAGCTGG - Intronic
991997749 5:72404810-72404832 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
992545388 5:77809923-77809945 TACTGAGAGGTGAAGCCAGCTGG + Intronic
992787976 5:80187982-80188004 TAGGTAAAACTGAAGGCAGAAGG + Intronic
993375280 5:87143210-87143232 TAGGGGCAGCTGAATCCAGCAGG - Intergenic
993702973 5:91140075-91140097 TGGTGAAAGCTGAAGCCACATGG - Intronic
996680001 5:126221220-126221242 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
997150412 5:131487714-131487736 TACTGAGAGGTGAAGCCAGCTGG - Intronic
997192532 5:131951328-131951350 TTGGGAAATCTGAAGCAAGAAGG + Exonic
997641607 5:135452190-135452212 TAAGGTAAGTTGAAGCCAGAGGG - Exonic
999158343 5:149474430-149474452 GAGGGAATGCTGGAGCCACCTGG - Intergenic
999443895 5:151623516-151623538 TTGGGGAAGCTGAAGCAAGAGGG + Intergenic
999445467 5:151635255-151635277 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
999605939 5:153315904-153315926 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
999794531 5:154976576-154976598 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1000135787 5:158349427-158349449 TTGGGAAAGCTAAACACAGCTGG - Intergenic
1000518352 5:162268761-162268783 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1000785329 5:165535752-165535774 TAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1000842530 5:166238752-166238774 AAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1001697250 5:173680273-173680295 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1001813571 5:174649001-174649023 GAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1001899544 5:175414153-175414175 TGGAAAAATCTGAAGCCAGCTGG + Intergenic
1002124000 5:177027941-177027963 AAAGAAAAGCCGAAGCCAGCTGG - Intronic
1002577460 5:180182806-180182828 TAGTGAGAGGTGAAGCCAGCTGG - Intronic
1002615563 5:180452993-180453015 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1002617560 5:180465015-180465037 TAGCGAGAGGTGAAGCCAGCTGG + Intergenic
1003039212 6:2671350-2671372 TAGGGAAAGCAGAAGGCATATGG + Intronic
1003271935 6:4614990-4615012 TGGTGAGAGGTGAAGCCAGCTGG - Intergenic
1003619285 6:7683552-7683574 CATGGAAGGATGAAGCCAGCAGG + Intergenic
1003715759 6:8644284-8644306 TAGTGAGAGGTGAAGCCAGCGGG + Intergenic
1003832802 6:10033216-10033238 TGGGGAAGGCTGAGCCCAGCAGG + Intronic
1004497936 6:16181976-16181998 TGGTGAGAGGTGAAGCCAGCTGG - Intergenic
1004550137 6:16638925-16638947 TATTGAGAGGTGAAGCCAGCTGG + Intronic
1005279567 6:24258566-24258588 TACGGAGAGGTGAAGCCAGCTGG - Intronic
1006230240 6:32580181-32580203 TAGTGAGAGGTGAAGCCAGCTGG - Intronic
1006594702 6:35184607-35184629 CAGGGAATGCTGAACCCACCAGG + Intergenic
1007077312 6:39075977-39075999 GGGAGAAAGATGAAGCCAGCAGG + Intronic
1007791950 6:44314586-44314608 AACAGAAAGCTAAAGCCAGCTGG + Intronic
1008272643 6:49507780-49507802 TAGTGAAAGCTGAGTCCAGGGGG + Intronic
1009672963 6:66779965-66779987 AAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1010039235 6:71361627-71361649 GAGGGCAAGCTGAAGCAAGGTGG - Intergenic
1010045716 6:71440896-71440918 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1010625508 6:78133039-78133061 TTGTGAGAGGTGAAGCCAGCTGG + Intergenic
1012625166 6:101395658-101395680 TAGTGAAAGATGAAGCTAGTGGG + Intergenic
1013113686 6:107084333-107084355 TACTGAGAGGTGAAGCCAGCTGG + Intronic
1013790528 6:113831616-113831638 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
1014143033 6:117965739-117965761 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
1014405001 6:121040253-121040275 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1014839190 6:126197833-126197855 TTGGGAGAGCTGAGGGCAGCTGG - Intergenic
1015032626 6:128613991-128614013 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1016170882 6:141014950-141014972 TAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1016676784 6:146779630-146779652 TAGGGAGACCAGAAGCCAGTGGG + Intronic
1016741060 6:147528977-147528999 CAGGGAAAGCTGAAGCAATCTGG - Intronic
1017017342 6:150112457-150112479 TAGAGCAAGCTGAAGCCACAGGG - Intergenic
1017306228 6:152921769-152921791 TAGGGAGGGCTGAAGACAACAGG + Intergenic
1017393894 6:153973668-153973690 TATTGAAAGCTGTAGTCAGCGGG + Intergenic
1017767695 6:157620329-157620351 TAGGGGCAGCTGAGGCCATCAGG - Intronic
1018256374 6:161923844-161923866 CAGGGAAAGAGGAAGCCAGGTGG - Intronic
1018734844 6:166679949-166679971 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
1021572334 7:22078929-22078951 TGGTGAGAGGTGAAGCCAGCTGG + Intergenic
1021757111 7:23862165-23862187 TACTGAGAGGTGAAGCCAGCTGG - Intergenic
1022238610 7:28487660-28487682 TTGGGAATGCTGAAGCTTGCTGG + Intronic
1022450326 7:30507839-30507861 CAGTGACAGGTGAAGCCAGCTGG - Intronic
1022457387 7:30570049-30570071 TAGTGAGAGGTGAAACCAGCTGG + Intergenic
1023338445 7:39194377-39194399 TAGTGAGAGGTGAAGCCAGCTGG + Intronic
1023498544 7:40824055-40824077 TAGGGAAAGTGGAAGTCAGAAGG + Intronic
1023557077 7:41435021-41435043 TAGTGAGAGGTGAAGCCGGCTGG + Intergenic
1024265541 7:47603507-47603529 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1024331932 7:48163413-48163435 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1024443204 7:49445874-49445896 TATTGAGAGATGAAGCCAGCTGG + Intergenic
1024820437 7:53322951-53322973 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1026172758 7:67968789-67968811 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1026307004 7:69151027-69151049 TAGTGAGAGCTGAGGCCAGGGGG - Intergenic
1026541526 7:71283788-71283810 TGGTGAAGGGTGAAGCCAGCTGG + Intronic
1027491530 7:78833420-78833442 TAGTGAAAGCTGAGTCCAGGGGG - Intronic
1027499282 7:78927909-78927931 TAGGGATAGCATAAGCCACCAGG - Intronic
1027570862 7:79865074-79865096 AAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1027946530 7:84752926-84752948 CAGGGAAAACTGAATCCAGGAGG + Intergenic
1030010842 7:105165375-105165397 TAGTGAGAGGTGAAGCCAGCTGG + Intronic
1030420113 7:109298986-109299008 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1031529443 7:122858252-122858274 TAATGAGAGGTGAAGCCAGCTGG - Intronic
1031744123 7:125471903-125471925 TGGAGAAATTTGAAGCCAGCTGG + Intergenic
1032057716 7:128697177-128697199 GAGGGAAGGGTAAAGCCAGCAGG + Intergenic
1032611891 7:133423937-133423959 TAGCGAGAGGTGAAGCCGGCTGG + Intronic
1032927821 7:136629169-136629191 TAATGAGAGGTGAAGCCAGCTGG + Intergenic
1035065678 7:156103485-156103507 TAGGGAAAGATGGTGCCAGATGG + Intergenic
1035431670 7:158828295-158828317 AAGGAAAAGCTGAAGCCACCCGG + Intronic
1036155011 8:6333371-6333393 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
1037373314 8:18203110-18203132 TAGTGAGAGCTGGAGCCAGCTGG - Intronic
1038392411 8:27214833-27214855 TAGGGAAACCTAAAGACAGCAGG + Intergenic
1038496765 8:28008754-28008776 TAGGGTAAACTGAAGCCATTTGG + Intergenic
1038686008 8:29719113-29719135 GAGGGGAAGCGGAAGGCAGCAGG - Intergenic
1039141565 8:34395034-34395056 TTGAGAAAGCTTAGGCCAGCTGG + Intergenic
1039275623 8:35932063-35932085 TAATGAGAGGTGAAGCCAGCTGG + Intergenic
1040526782 8:48232823-48232845 TATTGAGAGTTGAAGCCAGCTGG + Intergenic
1041680293 8:60582231-60582253 TAGGTTAAACTGAAGACAGCCGG - Intronic
1041981733 8:63869669-63869691 TAGAGAAAGCTGAATCCTGAGGG - Intergenic
1042328919 8:67557264-67557286 TAGTGGAAGGTGAAGCCTGCAGG + Intronic
1043057116 8:75453203-75453225 TGGTGAGAGGTGAAGCCAGCTGG + Intronic
1043256690 8:78147691-78147713 AAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1043270671 8:78329572-78329594 TTGTGAGAGATGAAGCCAGCTGG - Intergenic
1044068003 8:87722263-87722285 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1044996621 8:97843533-97843555 TTGGGGAGGCTGAAGCGAGCAGG + Intronic
1045198695 8:99956613-99956635 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1045861860 8:106822509-106822531 TAATGAGAGGTGAAGCCAGCTGG - Intergenic
1046193257 8:110827293-110827315 TAGGGAAACCTAAAGACAACAGG - Intergenic
1046507868 8:115159375-115159397 TGGTGACAGGTGAAGCCAGCTGG - Intergenic
1046864411 8:119129935-119129957 GAGCGATAGCTGAAGCCTGCAGG + Intergenic
1047129319 8:122001413-122001435 GAGGGCAAGCTGAAGCAAGGCGG + Intergenic
1047807435 8:128375032-128375054 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1048989699 8:139754091-139754113 CAGGGAAAGGTGAAGCCATGTGG + Intronic
1049117902 8:140705831-140705853 AAGGGCAAGGTGAAGCCAGTGGG - Intronic
1049379026 8:142302850-142302872 TAGGCACAGCGGAGGCCAGCAGG - Intronic
1049402386 8:142434225-142434247 TAGTGACAGCTGTGGCCAGCTGG + Intergenic
1049832688 8:144712507-144712529 TAATGAGAGGTGAAGCCAGCTGG - Intergenic
1049883976 9:15782-15804 TAGGGGAAGCAGGGGCCAGCTGG + Intergenic
1050872619 9:10592556-10592578 TAGTGAGAGGGGAAGCCAGCTGG + Intronic
1050923978 9:11240585-11240607 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1051447329 9:17154591-17154613 TATTGACAGGTGAAGCCAGCTGG + Intronic
1051555321 9:18376077-18376099 AAGTGAAAGGTGAAGCCAGCTGG - Intergenic
1051939371 9:22486615-22486637 TAGAGAACGCTGAACCCACCAGG - Intergenic
1051955453 9:22687604-22687626 TTGTGAGAGGTGAAGCCAGCTGG + Intergenic
1052318212 9:27138557-27138579 AAGTGAGAGGTGAAGCCAGCTGG - Intronic
1053010206 9:34628664-34628686 TAGGGAAAGACCAAGACAGCAGG + Intergenic
1053013708 9:34649852-34649874 TAAGGACTGCTGAAGCCACCAGG - Intronic
1053236336 9:36458140-36458162 TAATGAGAGGTGAAGCCAGCTGG + Intronic
1053638699 9:40044077-40044099 TACTGAGAGGTGAAGCCAGCTGG - Intergenic
1053767386 9:41421136-41421158 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
1054319493 9:63640640-63640662 TACTGAGAGGTGAAGCCAGCTGG - Intergenic
1054546052 9:66332631-66332653 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
1055456577 9:76477876-76477898 TAGTGAGAGGTGAAGCCAGCTGG + Intronic
1055458658 9:76495690-76495712 TATTGAGAGGTGAAGCCAGCTGG - Intronic
1055990276 9:82098630-82098652 TAATGAGAGGTGAAGCCAGCTGG + Intergenic
1056257267 9:84812892-84812914 TAGGGAATGATGAAAACAGCAGG + Intronic
1056273951 9:84974804-84974826 TAGGGAAAGCTGAAGCCAGCAGG - Intronic
1056884515 9:90428283-90428305 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1057280577 9:93708431-93708453 TAGAGAAAGCTGGAGCCACTCGG - Intergenic
1057310436 9:93939628-93939650 TGGTGAGAGGTGAAGCCAGCTGG + Intergenic
1057457900 9:95231050-95231072 TAATGAGAGGTGAAGCCAGCTGG - Intronic
1057509351 9:95664635-95664657 TATTGAAAGGTGAAGCCAGCTGG + Intergenic
1057516962 9:95729661-95729683 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1057526171 9:95803909-95803931 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1057547616 9:96030007-96030029 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1059381294 9:113928661-113928683 TAGGGAAATCTAAAGACAACAGG - Intronic
1059449183 9:114359650-114359672 CAGGGAAAGCAGAGGCCACCAGG - Exonic
1059458860 9:114416925-114416947 TCTGGAAAGCAGAACCCAGCTGG + Intronic
1060010724 9:120040868-120040890 GAGGCAAAGCTGGAGGCAGCCGG - Intergenic
1060345201 9:122809827-122809849 TAGTGAAAGCTGAGTCCAGGGGG - Intronic
1060653289 9:125349493-125349515 AAGAGAAAGCTGAATCCTGCGGG - Exonic
1061649031 9:132031213-132031235 TAGGGACAGCTGAAAACAGGTGG + Intronic
1061888961 9:133607669-133607691 TAGGGAAACCAAAACCCAGCTGG + Intergenic
1185794213 X:2950897-2950919 AAGGGATAGCTGGAGCCACCAGG - Intronic
1186068405 X:5791137-5791159 AAGGGACACCTGAAGCCACCAGG + Intergenic
1188176975 X:27002838-27002860 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1189892213 X:45615413-45615435 TAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1190541021 X:51479194-51479216 TAATGAGAGGTGAAGCCAGCTGG + Intergenic
1190588148 X:51967892-51967914 CAGTGATACCTGAAGCCAGCAGG + Intergenic
1191714737 X:64186573-64186595 TAAGGAAAGCTGCTGGCAGCAGG + Exonic
1192027488 X:67469571-67469593 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1192483208 X:71502496-71502518 TACTGAGAGGTGAAGCCAGCTGG - Intronic
1193431324 X:81409955-81409977 TGGGGAATGCTGACCCCAGCAGG + Intergenic
1193870881 X:86796411-86796433 TATTGAGAGGTGAAGCCAGCTGG - Intronic
1193888522 X:87013459-87013481 TATGGAGGGGTGAAGCCAGCTGG - Intergenic
1194066655 X:89269724-89269746 TTTTGAAAGGTGAAGCCAGCTGG - Intergenic
1194077720 X:89417272-89417294 CAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1194155618 X:90384242-90384264 TTTTGAAAGGTGAAGCCAGCTGG - Intergenic
1194156023 X:90389934-90389956 TAATGAGAGGTGAAGCCAGCCGG - Intergenic
1195118228 X:101721687-101721709 TAGGGAAACCTGGAGCCTCCTGG + Intergenic
1195215924 X:102702087-102702109 TAGGGAAACCCAAAGGCAGCAGG + Intergenic
1195974950 X:110516657-110516679 TGGGTAGAGCTGAAGCCTGCTGG - Intergenic
1196312872 X:114188998-114189020 TAGTGAGAGGTGAGGCCAGCTGG + Intergenic
1196419805 X:115509833-115509855 AAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1196419848 X:115510123-115510145 TACTGAGAGGTGAAGCCAGCTGG + Intergenic
1196488591 X:116243380-116243402 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1196663646 X:118294407-118294429 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1196681116 X:118470502-118470524 TATTGAGAGGTGAAGCCAGCTGG + Intergenic
1196853043 X:119956903-119956925 CAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1197398792 X:125962774-125962796 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1198465834 X:136904075-136904097 TATTGAAAGGTGAAGCCAGCTGG + Intergenic
1199795206 X:151188794-151188816 TAGGAAAAGCTAAAGACAACAGG + Intergenic
1200401832 X:156024377-156024399 TAGGGGAAGCAGGGGCCAGCTGG - Intergenic
1200430372 Y:3072817-3072839 CAGTGACAGGTGAAGCCAGCTGG + Intergenic
1200501966 Y:3961171-3961193 TTTTGAAAGGTGAAGCCAGCTGG - Intergenic
1200502371 Y:3966907-3966929 TAATGAGAGGTGAAGCCAGCCGG - Intergenic
1200569077 Y:4805211-4805233 TAGTGACAGGTGAAGCCAGCTGG + Intergenic
1200695316 Y:6353504-6353526 TAGTGACAGGTGAAGCCACCTGG - Intergenic
1200710917 Y:6484298-6484320 TAGGGAGAGGTGAAGCCACCTGG + Intergenic
1200720829 Y:6603902-6603924 TTTTGAAAGGTGAAGCCAGCTGG - Intergenic
1200749343 Y:6930513-6930535 CAGTGAGAGGTGAAGCCAGCTGG + Intronic
1200775848 Y:7169765-7169787 TGGTGAGAGATGAAGCCAGCTGG + Intergenic
1200776883 Y:7177263-7177285 GATTGAAAGGTGAAGCCAGCTGG + Intergenic
1200888350 Y:8295879-8295901 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic
1200945251 Y:8829309-8829331 TACTGAAAGGTAAAGCCAGCTGG + Intergenic
1201023017 Y:9677687-9677709 TAGGGAGAGGTGAAGCCACCTGG - Intergenic
1201039961 Y:9821206-9821228 TAGTGACAGGTGAAGCCACCTGG + Intergenic
1201279176 Y:12326245-12326267 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1201403373 Y:13627361-13627383 TACTGAGAGCTGAAGCCAGCTGG + Intergenic
1201630881 Y:16071027-16071049 GAGTGAGAGGTGAAGCCAGCTGG + Intergenic
1201902691 Y:19059526-19059548 TAGTGAAAGCTGAGTCCAGGGGG - Intergenic
1201929111 Y:19321695-19321717 TAGTGAGAGGTGAAGCTAGCTGG - Intergenic
1201931226 Y:19351658-19351680 TAGTGAGAGGAGAAGCCAGCTGG + Intergenic
1201989895 Y:20011788-20011810 TATTGAGAGGTGAAGCCAGCTGG - Intergenic
1202082405 Y:21097589-21097611 TAGTGAGAGGTGAAGCCAGCTGG - Intergenic